CCNL2 (NM_001039577) Human Untagged Clone

CAT#: SC310780

CCNL2 (untagged)-Human cyclin L2 (CCNL2), transcript variant 2



  "NM_001039577" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-CCNL2 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANIA-6B; CCNM; CCNS; HCLA-ISO; HLA-ISO; PCEE; SB138
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001039577, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGCGGCGGCGGCGGCTGGTGCTGCAGGGTCGGCAGCTCCCGCGGCAGCGGCC
GGCGCCCCGGGATCTGGGGGCGCACCCTCAGGGTCGCAGGGGGTGCTGATCGGGGACAGG
CTGTACTCCGGGGTGCTCATCACCTTGGAGAACTGCCTCCTGCCTGACGACAAGCTCCGT
TTCACGCCGTCCATGTCGAGCGGCCTCGACACCGACACAGAGACCGACCTCCGCGTGGTG
GGCTGCGAGCTCATCCAGGCGGCCGGTATCCTGCTCCGCCTGCCGCAGGTGGCCATGGCT
ACCGGGCAGGTGTTGTTCCAGCGGTTCTTTTATACCAAGTCCTTCGTGAAGCACTCCATG
GAGCATGTGTCAATGGCCTGTGTCCACCTGGCTTCCAAGATAGAAGAGGCCCCAAGACGC
ATACGGGACGTCATCAATGTGTTTCACCGCCTTCGACAGCTGAGAGACAAAAAGAAGCCC
GTGCCTCTACTACTGGATCAAGATTATGTTAATTTAAAGAACCAAATTATAAAGGCGGAA
AGACGAGTTCTCAAAGAGTTGGGTTTCTGCGTCCATGTGAAGCATCCTCATAAGATAATC
GTTATGTACCTTCAGGTGTTAGAGTGTGAGCGTAACCAACACCTGGTCCAGACCTCATGG
GTAGCCTCTGAGGGTAAGTGA
Restriction Sites Please inquire     
ACCN NM_001039577
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039577.1, NP_001034666.1
RefSeq Size 5260 bp
RefSeq ORF 681 bp
Locus ID 81669
UniProt ID Q96S94
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the cyclin family. Through its interaction with several proteins, such as RNA polymerase II, splicing factors, and cyclin-dependent kinases, this protein functions as a regulator of the pre-mRNA splicing process, as well as in inducing apoptosis by modulating the expression of apoptotic and antiapoptotic proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2, also known as L2betaA3 or T3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (B), also known as L2betaA, contains the cyclin box in the N-terminus and lacks the arginine/serine-rich domain (RS domain) in the C-terminus, compared to isoform A. CCDS Note: This CCDS represents the L2betaA isoform of the cyclin L2 locus, as described in PMID:18216018. The transcript is supported by BC016333.1, which is processed at an internal polyA site compared to other transcripts at this locus. The mRNA AK074112.1 also contains the same CDS. However, because the latter mRNA has additional 3' exon structure and the stop codon is present in an internal exon, that transcript is expected to be subject to nonsense-mediated mRNA decay (NMD), whereas transcripts processed at the internal polyA site are predicted to be translated.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...