MLT5 (TESMIN) (NM_001039656) Human Untagged Clone

CAT#: SC310754

MTL5 (untagged)-Human metallothionein-like 5, testis-specific (tesmin) (MTL5), transcript variant 2



  "NM_001039656" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MTL5 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CXCDC2; MTL5; MTLT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310754 representing NM_001039656.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGGGCCCTCTGCCGGGCGGGCTGCCCAGCCCCGAGGATGCGATGGTGACGGAGCTCTTAAGC
CCCGAGGGTCCGTTCGCTTCGGAGAACATCGGCCTGAAGGCCCCCGTGAAGTACGAGGAGGACGAGTTC
CACGTCTTCAAAGAAGCGTACCTGGGCCCGGCGGACCCCAAGGAACCCGTCCTGCACGCGTTCAACCCC
GCGCTGGGCGCCGACTGCAAGGGCCAGGTCAAGGCGAAGCTCGCGGGGGGCGACAGCGACGGCGGGGAG
CTCCTCGGGGAGTACCCCGGGATCCCAGAGCTCAGCGCGCTGGAGGACGTCGCGCTCCTGCAGGCCCCG
CAGCCGCCCGCCTGCAACGTGCACTTCCTGTCCTCGCTGCTACCCGCGCACCGCAGCCCGGCGGTGTTG
CCCCTGGGCGCCTGGGTCCTGGAAGGAGCCTCCCACCCGGGCGTCCGCATGATCCCAGTTGAAATCAAG
GAAGCAGGTGGTACTACTACAAGTAATAATCCGGAAGAAGCAACTTTGCAGAATCTTCTTGCTCAGGAA
TCCTGTTGCAAGTTCCCATCGTCCCAGGAACTAGAGGATGCCTCCTGCTGTTCTCTTAAGAAAGATTCC
AACCCAATGGTGATATGCCAATTGAAAGGGGGCACACAAATGCTATGTATAGACAATTCTAGAACAAGA
GAACTAAAAGCACTCCATTTGGTTCCTCAGTATCAAGATCAAAATAATTATCTACAGTCAGATGTCCCT
AAACCAATGACTGCTTTAGTAGGGAGATTTTTGCCAGCATCAACAAAATTAAATCTCATTACACAACAA
CTTGAGGGAGCCTTACCATCGGTAGTCAACGGGTCTGCTTTCCCCTCGGGATCAACTCTTCCAGGACCA
CCAAAAATAACTTTGGCTGGGTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001039656
Insert Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039656.1
RefSeq Size 3625 bp
RefSeq ORF 921 bp
Locus ID 9633
UniProt ID Q9Y4I5
Protein Families Druggable Genome
MW 32.3 kDa
Gene Summary Metallothionein proteins are highly conserved low-molecular-weight cysteine-rich proteins that are induced by and bind to heavy metal ions and have no enzymatic activity. They may play a central role in the regulation of cell growth and differentiation and are involved in spermatogenesis. This gene encodes a metallothionein-like protein which has been shown to be expressed differentially in mouse testis and ovary. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter at the C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...