SPAG8 (NM_001039592) Human Untagged Clone
CAT＃: SC310751
SPAG8 (untagged)-Human sperm associated antigen 8 (SPAG8), transcript variant 1
CNY 7790.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BS-84; CILD28; CT142; HSD-1; hSMP-1; SMP1; SPAG3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001039592, the custom clone sequence may differ by one or more nucleotides
ATGGAGACCAACGAGTCTACGGAGGGATCGCGGTCGCGGTCGCGATCTTTAGACATACAG CCCAGCTCCGAAGGACTGGGGCCCACTTCGGAACCGTTTCCTTCTTCAGATGACAGTCCC AGGTCGGCCCTGGCAGCTGCAACCGCAGCAGCTGCAGCGGCTGCATCAGCTGCTGCAGCT ACTGCAGCCTTCACCACTGCCAAAGCAGCTGCATTATCTACAAAGACCCCAGCGCCCTGT TCTGAGTTCATGGAGCCGTCCTCTGACCCCAGCCTTCTTGGGGAGCCCTGTGCGGGACCC GGCTTTACCCACAATATAGCCCATGGGAGTCTTGGCTTTGAGCCCGTCTATGTTTCCTGT ATTGCTCAGGACACTTGCACTACAACTGACCATAGTTCTAATCCTGGCCCTGTTCCAGGC TCTAGCTCTGGGCCTGTTCTTGGTTCCAGCTCAGGTGCTGGCCATGGCTCTGGCTCTGGC TCTGGTCCTGGCTGTGGCTCTGTCCCTGGCTCTGGCTCTGGTCCTGGTCCTGGCTCTGGT CCTGGCTCTGGTCCTGGTCATGGCTCTGGCTCTCATCCTGGTCCTGCCTCTGGGCCTGGT CCAGACACTGGCCCTGACTCTGAGCTCAGCCCCTGTATTCCTCCAGGGTTCAGAAACCTG GTGGCAGATCGGGTCCCTAACTATACCTCCTGGAGTCAGCACTGCCCCTGGGAGCCCCAG AAACAACCACCTTGGGAATTTTTGCAAGTCTTAGAACCGGGTGCCCGAGGACTATGGAAA CCCCCAGACATTAAAGGGAAGCTTATGGTTTGCTATGAAACTTTGCCGCGGGGCCAGTGC CTCCTCTACAACTGGGAGGAAGAGAGAGCCACCAACCACCTGGATCAAGTCCCAAGCATG CAGGATGGCTCTGAGAGTTTTTTCTTCCGACACGGACACCGGGGACTGCTGACTATGCAA CTAAAGTCACCCATGCCCTCCAGCACCACCCAGAAAGACTCGTACCAGCCACCAGGAAAC GTCTATTGGCCACTTCGAGGGAAGCGTGAAGCCATGCTGGAGATGCTCCTGCAGCATCAG ATCTGTAAAGAGGTGCAGGCAGAACAGGAACCCACAAGGAAGCTCTTCGAGGTTGAGTCT GTGACACACCATGACTACCGAATGGAGCTGGCACAAGCAGGGACTCCTGCCCCAACAAAG CCTCACGACTACCGCCAGGAGCAACCTGAGACCTTCTGGATACAGAGGGCACCACAGCTG CCGGGTGTCAGTAACATCAGGACATTGGACACACCATTCCGGAAGAACTGCAGCTTCTCA ACACCAGTACCCTTGTCTCTGGGGAAACTTTTGCCCTATGAACCTGAGAATTACCCCTAC CAATTGGGAGAAATATCTTCCCTTCCCTGTCCCGGAGGAAGGCTGGGTGGTGGAGGGGGG AGAATGACTCCTTTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001039592 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039592.1, NP_001034681.1 |
| RefSeq Size | 1715 bp |
| RefSeq ORF | 1458 bp |
| Locus ID | 26206 |
| UniProt ID | Q99932 |
| Gene Summary | The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) includes an alternate exon in the 3' coding region, compared to variant 2. The resulting protein (isoform 1) is shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219119 | SPAG8 (Myc-DDK-tagged)-Human sperm associated antigen 8 (SPAG8), transcript variant 1. Note: ORF is codon optimized |
CNY 3656.00 |
|
| RC219119L3 | Lenti-ORF clone of SPAG8 (Myc-DDK-tagged)-Human sperm associated antigen 8 (SPAG8), transcript variant 1. Note: ORF is codon optimized |
CNY 5890.00 |
|
| RC219119L4 | Lenti-ORF clone of SPAG8 (mGFP-tagged)-Human sperm associated antigen 8 (SPAG8), transcript variant 1. Note: ORF is codon optimized |
CNY 5890.00 |
|
| RG219119 | SPAG8 (tGFP-tagged) - Human sperm associated antigen 8 (SPAG8), transcript variant 1. Note: ORF is codon optimized |
CNY 4370.00 |
