SPAG8 (NM_001039592) Human Untagged Clone

CAT#: SC310751

SPAG8 (untagged)-Human sperm associated antigen 8 (SPAG8), transcript variant 1



  "NM_001039592" in other vectors (4)

CNY 7790.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-SPAG8 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BS-84; CILD28; CT142; HSD-1; hSMP-1; SMP1; SPAG3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001039592, the custom clone sequence may differ by one or more nucleotides
ATGGAGACCAACGAGTCTACGGAGGGATCGCGGTCGCGGTCGCGATCTTTAGACATACAG
CCCAGCTCCGAAGGACTGGGGCCCACTTCGGAACCGTTTCCTTCTTCAGATGACAGTCCC
AGGTCGGCCCTGGCAGCTGCAACCGCAGCAGCTGCAGCGGCTGCATCAGCTGCTGCAGCT
ACTGCAGCCTTCACCACTGCCAAAGCAGCTGCATTATCTACAAAGACCCCAGCGCCCTGT
TCTGAGTTCATGGAGCCGTCCTCTGACCCCAGCCTTCTTGGGGAGCCCTGTGCGGGACCC
GGCTTTACCCACAATATAGCCCATGGGAGTCTTGGCTTTGAGCCCGTCTATGTTTCCTGT
ATTGCTCAGGACACTTGCACTACAACTGACCATAGTTCTAATCCTGGCCCTGTTCCAGGC
TCTAGCTCTGGGCCTGTTCTTGGTTCCAGCTCAGGTGCTGGCCATGGCTCTGGCTCTGGC
TCTGGTCCTGGCTGTGGCTCTGTCCCTGGCTCTGGCTCTGGTCCTGGTCCTGGCTCTGGT
CCTGGCTCTGGTCCTGGTCATGGCTCTGGCTCTCATCCTGGTCCTGCCTCTGGGCCTGGT
CCAGACACTGGCCCTGACTCTGAGCTCAGCCCCTGTATTCCTCCAGGGTTCAGAAACCTG
GTGGCAGATCGGGTCCCTAACTATACCTCCTGGAGTCAGCACTGCCCCTGGGAGCCCCAG
AAACAACCACCTTGGGAATTTTTGCAAGTCTTAGAACCGGGTGCCCGAGGACTATGGAAA
CCCCCAGACATTAAAGGGAAGCTTATGGTTTGCTATGAAACTTTGCCGCGGGGCCAGTGC
CTCCTCTACAACTGGGAGGAAGAGAGAGCCACCAACCACCTGGATCAAGTCCCAAGCATG
CAGGATGGCTCTGAGAGTTTTTTCTTCCGACACGGACACCGGGGACTGCTGACTATGCAA
CTAAAGTCACCCATGCCCTCCAGCACCACCCAGAAAGACTCGTACCAGCCACCAGGAAAC
GTCTATTGGCCACTTCGAGGGAAGCGTGAAGCCATGCTGGAGATGCTCCTGCAGCATCAG
ATCTGTAAAGAGGTGCAGGCAGAACAGGAACCCACAAGGAAGCTCTTCGAGGTTGAGTCT
GTGACACACCATGACTACCGAATGGAGCTGGCACAAGCAGGGACTCCTGCCCCAACAAAG
CCTCACGACTACCGCCAGGAGCAACCTGAGACCTTCTGGATACAGAGGGCACCACAGCTG
CCGGGTGTCAGTAACATCAGGACATTGGACACACCATTCCGGAAGAACTGCAGCTTCTCA
ACACCAGTACCCTTGTCTCTGGGGAAACTTTTGCCCTATGAACCTGAGAATTACCCCTAC
CAATTGGGAGAAATATCTTCCCTTCCCTGTCCCGGAGGAAGGCTGGGTGGTGGAGGGGGG
AGAATGACTCCTTTCTGA
Restriction Sites Please inquire     
ACCN NM_001039592
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039592.1, NP_001034681.1
RefSeq Size 1715 bp
RefSeq ORF 1458 bp
Locus ID 26206
UniProt ID Q99932
Gene Summary The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) includes an alternate exon in the 3' coding region, compared to variant 2. The resulting protein (isoform 1) is shorter and has a distinct C-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...