DUSP10 (NM_144729) Human Untagged Clone

CAT#: SC310672

DUSP10 (untagged)-Human dual specificity phosphatase 10 (DUSP10), transcript variant 3



  "NM_144729" in other vectors (4)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DUSP10 mouse monoclonal antibody, clone OTI2H1 (formerly 2H1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MKP-5; MKP5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310672 representing NM_144729.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGCGGCTGAACATCGGCTACGTCATCAACGTCACCACTCATCTTCCCCTCTACCACTATGAGAAA
GGCCTGTTCAACTACAAGCGGCTGCCAGCCACTGACAGCAACAAGCAGAACCTGCGGCAGTACTTTGAA
GAGGCTTTTGAGTTCATTGAGGAAGCTCACCAGTGTGGGAAGGGGCTTCTCATCCACTGCCAGGCTGGG
GTGTCCCGCTCCGCCACCATCGTCATCGCTTACTTGATGAAGCACACTCGGATGACCATGACTGATGCT
TATAAATTTGTCAAAGGCAAACGACCAATTATCTCCCCAAACCTTAACTTCATGGGGCAGTTGCTAGAG
TTCGAGGAAGACCTAAACAACGGTGTGACACCGAGAATCCTTACACCAAAGCTGATGGGCGTGGAGACG
GTTGTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_144729
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_144729.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_144729.2
RefSeq Size 1824 bp
RefSeq ORF 423 bp
Locus ID 11221
Domains DSPc
Protein Families Druggable Genome, Phosphatase
Protein Pathways MAPK signaling pathway
MW 16.1 kDa
Gene Summary Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (3) differs in the 5' UTR and coding region compared to variant 1, resulting in an isoform (b) that is shorter at the N-terminus compared to isoform a. Both variants 2 and 3 encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...