IMMP1L (NM_144981) Human Untagged Clone
CAT#: SC310652
IMMP1L (untagged)-Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IMMP1; IMP1; IMP1-LIKE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310652 representing NM_144981.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTCGTGGTGTTCTGGGGAAAACCTTTCGACTTGTTGGCTATACTATTCAATATGGCTGTATAGCT CATTGTGCTTTTGAATACGTTGGTGGTGTTGTCATGTGTTCTGGACCATCAATGGAGCCTACAATTCAA AATTCAGATATTGTCTTTGCAGAAAATCTTAGTCGACATTTTTATGGTATCCAAAGAGGTGACATTGTG ATTGCAAAAAGCCCAAGTGATCCAAAATCAAATATTTGTAAAAGAGTAATTGGTTTGGAAGGAGACAAA ATCCTCACCACTAGTCCATCAGATTTCTTTAAAAGCCATAGTTATGTGCCAATGGGTCATGTTTGGTTA GAAGGTGACAATCTACAGAATTCTACAGATTCCAGGTGCTATGGACCTATTCCATATGGACTAATAAGA GGACGAATCTTCTTTAAGATTTGGCCTCTGAGTGATTTTGGATTTTTACGTGCCAGCCCTAATGGCCAC AGATTTTCTGATGATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_144981 |
| Insert Size | 501 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_144981.2 |
| RefSeq Size | 821 bp |
| RefSeq ORF | 501 bp |
| Locus ID | 196294 |
| UniProt ID | Q96LU5 |
| Domains | Peptidase_S26 |
| Protein Families | Protease |
| MW | 18.5 kDa |
| Gene Summary | The mitochondrial inner membrane peptidase (IMP) complex generates mature, active proteins in the mitochondrial intermembrane space by proteolytically removing the mitochondrial targeting presequence of nuclear-encoded proteins. IMP1 and IMP2 (IMMP2L; MIM 605977) are the catalytic subunits of the IMP complex (Burri et al., 2005 [PubMed 15814844]).[supplied by OMIM, Sep 2008] Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204909 | IMMP1L (Myc-DDK-tagged)-Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| RC204909L3 | Lenti ORF clone of Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204909L4 | Lenti ORF clone of Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RG204909 | IMMP1L (tGFP-tagged) - Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein |
CNY 4370.00 |
|
| SC320466 | IMMP1L (untagged)-Human IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP1L), nuclear gene encoding mitochondrial protein |
CNY 2400.00 |
