RAMP2 (NM_005854) Human Untagged Clone
CAT#: SC310647
RAMP2 (untagged)-Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2)
CNY 3600.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_005854 edited
TCGCCTCCTTGCTGCACGATGGCCTCGCTCCGGGTGGAGCGCGCCGGCGGCCCGCGTCTC CCTAGGACCCGAGTCGGGCGGCCGGCAGCGCTCCGCCTCCTCCTCCTGCTGGGCGCTGTC CTGAATCCCCACGAGGCCCTGGCTCAGCCTCTTCCCACCACAGGCACACCAGGGTCAGAA GGGGGGACGGTGAAGAACTATGAGACAGCTGTCCAATTTTGCTGGAATCATTATAAGGAT CAAATGGATCCTATCGAAAAGGATTGGTGCGACTGGGCCATGATTAGCAGGCCTTATAGC ACCCTGCGAGATTGCCTGGAGCACTTTGCAGAGTTGTTTGACCTGGGCTTCCCCAATCCC TTGGCAGAGAGGATCATCTTTGAGACTCACCAGATCCACTTTGCCAACTGCTCCCTGGTG CAGCCCACCTTCTCTGACCCCCCAGAGGATGTACTCCTGGCCATGATCATAGCCCCCATC TGCCTCATCCCCTTCCTCATCACTCTTGTAGTATGGAGGAGTAAAGACAGTGAGGCCCAG GCCTAGGGGGCCACGAGCTTCTCAACAACCATGTTACTCCACTTCCCCACCCCCACCAGG CCTCCCTCCTCCCCTCCTACTCCCTTTTCTCACTCTCATCCCCACCACAGATCCCTGGAT TGCTGGGAATGGAAGCCAGGTGGGGTCATGGCACAAGTTCTGTAATCTTCAAAATAAAAC TTTTTTTTTGTACAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_005854 |
| Insert Size | 528 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005854.1, NP_005845.1 |
| RefSeq Size | 780 bp |
| RefSeq ORF | 528 bp |
| Locus ID | 10266 |
| UniProt ID | O60895 |
| Domains | RAMP |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Vascular smooth muscle contraction |
| Gene Summary | The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC206531 | RAMP2 (Myc-DDK-tagged)-Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2) |
CNY 3600.00 |
|
| RC206531L1 | Lenti ORF clone of Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC206531L2 | Lenti ORF clone of Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2), mGFP tagged |
CNY 5890.00 |
|
| RC206531L3 | Lenti ORF clone of Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC206531L4 | Lenti ORF clone of Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2), mGFP tagged |
CNY 6000.00 |
|
| RG206531 | RAMP2 (tGFP-tagged) - Human receptor (G protein-coupled) activity modifying protein 2 (RAMP2) |
CNY 5200.00 |
