NUCKS1 (NM_022731) Human Untagged Clone
CAT#: SC310605
NUCKS1 (untagged)-Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JC7; NUCKS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310605 representing NM_022731.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGCGGCCTGTCAGAAATAGGAAGGTTGTTGATTACTCACAGTTTCAGGAATCTGATGATGCAGAT GAAGATTATGGAAGAGATTCGGGCCCTCCCACTAAGAAAATTCGATCATCTCCCCGAGAAGCTAAAAAT AAGAGGCGATCTGGAAAGAATTCACAGGAAGATAGTGAGGACTCAGAAGACAAAGATGTGAAGACCAAG AAGGATGATTCTCACTCAGCAGAGGATAGTGAAGATGAAAAAGAAGATCATAAAAATGTGCGCCAACAA CGGCAGGCGGCATCTAAAGCAGCTTCTAAACAGAGAGAGATGCTCATGGAAGATGTGGGCAGTGAGGAA GAACAAGAAGAGGAGGATGAGGCACCATTCCAGGAGAAAGATTCCGGCAGCGATGAAGATTTCCTAATG GAAGATGATGACGATAGTGACTATGGCAGTTCGAAAAAGAAAAACAAAAAGATGGTTAAGAAGTCCAAA CCTGAAAGAAAAGAAAAGAAAATGCCCAAACCCAGACTAAAGGCTACAGTGACGCCAAGTCCAGTGAAA GGCAAAGGGAAAGTGGGTCGCCCCACAGCTTCAAAGGCATCAAAGGAAAAGACTCCTTCTCCCAAAGAA GAAGATGAGGAACCGGAAAGCCCGCCAGAAAAGAAAACATCTACAAGCCCCCCACCCGAGAAATCTGGG GATGAAGGGTCTGAAGATGAAGCCCCTTCTGGGGAGGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022731 |
Insert Size | 732 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022731.4 |
RefSeq Size | 6471 bp |
RefSeq ORF | 732 bp |
Locus ID | 64710 |
UniProt ID | Q9H1E3 |
Protein Families | Druggable Genome |
MW | 27.3 kDa |
Gene Summary | This gene encodes a nuclear protein that is highly conserved in vertebrates. The conserved regions of the protein contain several consensus phosphorylation sites for casein kinase II and cyclin-dependent kinases, two putative nuclear localization signals, and a basic DNA-binding domain. It is phosphorylated in vivo by Cdk1 during mitosis of the cell cycle. [provided by RefSeq, Aug 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201704 | NUCKS1 (Myc-DDK-tagged)-Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1) |
CNY 2400.00 |
|
RC201704L1 | Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), Myc-DDK-tagged |
CNY 4800.00 |
|
RC201704L2 | Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), mGFP tagged |
CNY 5890.00 |
|
RC201704L3 | Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC201704L4 | Lenti ORF clone of Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1), mGFP tagged |
CNY 5890.00 |
|
RG201704 | NUCKS1 (tGFP-tagged) - Human nuclear casein kinase and cyclin-dependent kinase substrate 1 (NUCKS1) |
CNY 4000.00 |