TEF1 (TEAD1) (NM_021961) Human Untagged Clone
CAT#: SC310426
TEAD1 (untagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1)
CNY 5,856.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AA; NTEF-1; REF1; TCF-13; TCF13; TEAD-1; TEF-1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_021961, the custom clone sequence may differ by one or more nucleotides
ATTGAGCCCAGCAGCTGGAGCGGCAGTGAGAGCCCTGCCGAAAACATGGAAAGGATGAGTGACTCTGCAG ATAAGCCAATTGACAATGATGCAGAAGGGGTCTGGAGCCCCGACATCGAGCAAAGCTTTCAGGAGGCCCT GGCTATCTATCCACCATGTGGGAGGAGGAAAATCATCTTATCAGACGAAGGCAAAATGTATGGTAGGAAT GAATTGATAGCCAGATACATCAAACTCAGGACAGGCAAGACGAGGACCAGAAAACAGGTGTCTAGTCACA TTCAGGTTCTTGCCAGAAGGAAATCTCGTGATTTTCATTCCAAGCTAAAGGATCAGACTGCAAAGGATAA GGCCCTGCAGCACATGGCGGCCATGTCCTCAGCCCAGATCGTCTCGGCCACTGCCATTCATAACAAGCTG GGGCTGCCTGGGATTCCACGCCCGACCTTCCCAGGGGCGCCGGGGTTCTGGCCGGGAATGATTCAAACAG GGCAGCCAGGATCCTCACAAGACGTCAAGCCTTTTGTGCAGCAGGCCTACCCCATCCAGCCAGCGGTCAC AGCCCCCATTCCAGGGTTTGAGCCTGCATCGGCCCCAGCTCCCTCAGTCCCTGCCTGGCAAGGTCGCTCC ATTGGCACAACCAAGCTTCGCCTGGTGGAATTTTCAGCTTTTCTCGAGCAGCAGCGAGACCCAGACTCGT ACAACAAACACCTCTTCGTGCACATTGGGCATGCCAACCATTCTTACAGTGACCCATTGCTTGAATCAGT GGACATTCGTCAGATTTATGACAAATTTCCTGAAAAGAAAGGTGGCTTAAAGGAACTGTTTGGAAAGGGC CCTCAAAATGCCTTCTTCCTCGTAAAATTCTGGGCTGATTTAAACTGCAATATTCAAGATGATGCTGGGG CTTTTTATGGTGTAACCAGTCAGTACGAGAGTTCTGAAAATATGACAGTCACCTGTTCCACCAAAGTTTG CTCCTTTGGGAAGCAAGTAGTAGAAAAAGTAGAGACGGAGTATGCAAGGTTTGAGAATGGCCGATTTGTA TACCGAATAAACCGCTCCCCAATGTGTGAATATATGATCAACTTCATCCACAAGCTCAAACACTTACCAG AGAAATATATGATGAACAGTGTTTTGGAAAACTTCACAATTTTATTGGTGGTAACAAACAGGGATACACA AGAAACTCTACTCTGCATGGCCTGTGTGTTTGAAGTTTCAAATAGTGAACACGGAGCACAACATCATATT TACAGGCTTGTAAAGGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_021961 |
Insert Size | 1281 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021961.5, NP_068780.2 |
RefSeq Size | 9433 bp |
RefSeq ORF | 1281 bp |
Locus ID | 7003 |
UniProt ID | P28347 |
Domains | TEA |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215492 | TEAD1 (Myc-DDK-tagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 5,488.00 |
|
RC215492L1 | Lenti-ORF clone of TEAD1 (Myc-DDK-tagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 7,888.00 |
|
RC215492L2 | Lenti-ORF clone of TEAD1 (mGFP-tagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 5,890.00 |
|
RC215492L3 | Lenti-ORF clone of TEAD1 (Myc-DDK-tagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 7,888.00 |
|
RC215492L4 | Lenti-ORF clone of TEAD1 (mGFP-tagged)-Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 7,888.00 |
|
RG215492 | TEAD1 (tGFP-tagged) - Human TEA domain family member 1 (SV40 transcriptional enhancer factor) (TEAD1) |
CNY 7,088.00 |