FDPS (NM_002004) Human Untagged Clone

CAT#: SC310416

FDPS (untagged)-Human farnesyl diphosphate synthase (FDPS), transcript variant 1



  "NM_002004" in other vectors (6)

CNY 3656.00

CNY 6750.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


FDPS rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FPPS; FPS; POROK9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002004 edited
ATGCCCCTGTCCCGCTGGTTGAGATCTGTGGGGGTCTTCCTGCTGCCAGCCCCCTACTGG
GCACCCCGGGAGAGGTGGCTGGGTTCCCTACGGCGGCCCTCCCTGGTGCACGGGTACCCA
GTCCTGGCCTGGCACAGTGCCCGCTGCTGGTGCCAAGCGTGGACAGAGGAACCTCGAGCC
CTTTGCTCCTCCCTCAGAATGAACGGAGACCAGAATTCAGATGTTTATGCCCAAGAAAAG
CAGGATTTCGTTCAGCACTTCTCCCAGATCGTTAGGGTGCTGACTGAGGATGAGATGGGG
CACCCAGAGATAGGAGATGCTATTGCCCGGCTCAAGGAGGTCCTGGAGTACAATGCCATT
GGAGGCAAGTATAACCGGGGTTTGACGGTGGTAGTAGCATTCCGGGAGCTGGTGGAGCCA
AGGAAACAGGATGCTGATAGTCTCCAGCGGGCCTGGACTGTGGGCTGGTGTGTGGAACTG
CTGCAAGCTTTCTTCCTGGTGGCAGATGACATCATGGATTCATCCCTTACCCGCCGGGGA
CAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCCATCAATGATGCTAACCTC
CTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCCTATTACCTG
AACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGAC
CTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAA
TCTATTGTCAAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATG
TACATGGCAGGAATTGATGGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAG
ATGGGGGAGTTCTTTCAGATTCAGGATGATTACCTTGACCTCTTTGGGGACCCCAGTGTG
ACCGGCAAAATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGT
CTGCAACGGGCCACTCCAGAACAGTACCAGATCCTGAAGGAAAATTACGGGCAGAAGGAG
GCTGAGAAAGTGGCCCGGGTGAAGGCGCTATATGAGGAGCTGGATCTGCCAGCAGTGTTC
TTGCAATATGAGGAAGACAGTTACAGCCACATTATGGCTCTCATTGAACAGTACGCAGCA
CCCCTGCCCCCAGCCGTCTTTCTGGGGCTTGCGCGCAAAATCTACAAGCGGAGAAAGTGA
Restriction Sites Please inquire     
ACCN NM_002004
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002004.2, NP_001995.1
RefSeq Size 1345 bp
RefSeq ORF 1260 bp
Locus ID 2224
UniProt ID P14324
Domains polyprenyl_synt
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
Gene Summary This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Both variants 1 and 2 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...