SEPN1 (SELENON) (NM_020451) Human Untagged Clone
CAT#: SC310234
SEPN1 (untagged)-Human selenoprotein N, 1 (SEPN1), transcript variant 1 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 9600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Synonyms | CFTD; MDRS1; RSMD1; RSS; SELN; SEPN1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_020451, the custom clone sequence may differ by one or more nucleotides
ATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCT CCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCC GCCGCTGCCGCCGCCGTCCGGGTCTGCGCCCGCCACGCCGAGGCCCAGGCGGCCGCGCGG CAGGAACTGGCGCTGAAGACCCTGGGGACAGATGGCCTTTTTCTCTTTTCCTCCTTGGAC ACTGACGGGGATATGTACATCAGCCCTGAGGAGTTCAAACCCATTGCTGAGAAGCTAACA GGGTCTTGTTCTGTCACCCAGACTGGAGTGCAGTGGTGCAGTCACAGCTCACTGCAGCCT CAACTTCCCTGGCTCAATTGATCCTCCTGCCTCAGCCTCCTGAGGTCAACTCCCGCGGCC AGCTGCGAGGAGGAGGAGTTGCCCCCTGACCCTAGCGAGGAGACGCTCACCATAGAAGCC CGATTCCAGCCTCTGCTCCCGGAGACCATGACCAAGAGCAAAGATGGCTTCCTAGGGGTC TCCCGCCTCGCCCTGTCCGGCCTCCGAAACTGGACAGCCGCCGCCTCACCAAGTGCAGTG TTTGCCACCCGCCACTTCCAGCCCTTCCTTCCCCCGCCAGGCCAGGAGCTGGGTGAGCCC TGGTGGATCATCCCCAGTGAGCTGAGCATGTTCACTGGCTACCTGTCCAACAACCGCTTC TATCCACCGCCGCCCAAGGGCAAGGAGGTCATCATCCACCGGCTCCTGAGCATGTTCCAC CCTCGGCCCTTTGTGAAGACCCGCTTTGCCCCTCAGGGAGCTGTGGCCTGCCTGACTGCC ATCAGCGACTTCTACTACACTGTGATGTTCCGGATCCATGCCGAGTTCCAGCTCAGTGAG CCGCCCGACTTCCCCTTTTGGTTCTCCCCTGCTCAGTTCACCGGCCACATCATCCTCTCC AAAGACGCCACCCACGTCCGCGACTTCCGGCTCTTCGTGCCCAACCACAGGTCTCTGAAT GTGGACATGGAGTGGCTTTACGGGGCCAGTGAAAGCAGCAACATGGAGGTGGACATCGGC TACATACCCCAGATGGAGCTGGAGGCCACGGGCCCCTCTGTGCCCTCCGTGATCCTGGAT GAGGATGGCAGCATGATCGACAGCCACCTGCCTTCAGGGGAGCCCCTGCAGTTTGTGTTT GAGGAGATCAAGTGGCAGCAGGAGCTGAGCTGGGAGGAGGCTGCCCGGCGCCTGGAGGTG GCCATGTACCCCTTCAAGAAGGTCTCCTACTTGCCGTTCACTGAGGCCTTCGACCGAGCC AAGGCTGAGAACAAGCTGGTGCACTCAATCCTGCTGTGGGGGGCCCTGGATGACCAGTCC TGCTGAGGTTCAGGGCGGACTCTCCGGGAGACTGTCCTGGAAAGTTCGCCCATCCTCACC CTGCTCAACGAGAGCTTCATCAGCACCTGGTCCCTGGTGAAGGAGCTGGAGGAACTGCAG AACAACCAGGAGAACTCGTCCCACCAGAAGCTGGCTGGCCTGCACCTGGAGAAGTACAGC TTCCCCGTGGAGATGATGATCTGCCTGCCCAATGGCACCGTGGTCCATCACATCAATGCC AACTACTTCTTGGACATCACCTCCGTGAAGCCCGAGGAAATCGAGAGCAATCTCTTCAGC TTCTCATCCACCTTTGAAGACCCGTCCACGGCCACCTACATGCAGTTCCTGAAGGAGGGA CTCCGGCGTGGCCTGCCCCTCCTCCAGCCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_020451 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
| OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020451.2, NP_065184.2 |
| RefSeq Size | 4357 bp |
| Locus ID | 57190 |
| UniProt ID | Q9NZV5 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a glycoprotein that is localized in the endoplasmic reticulum. It plays an important role in cell protection against oxidative stress, and in the regulation of redox-related calcium homeostasis. Mutations in this gene are associated with early onset muscle disorders, referred to as SEPN1-related myopathy. SEPN1-related myopathy consists of 4 autosomal recessive disorders, originally thought to be separate entities: rigid spine muscular dystrophy (RSMD1), the classical form of multiminicore disease, desmin related myopathy with Mallory-body like inclusions, and congenital fiber-type disproportion (CFTD). This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. A second stop-codon redefinition element (SRE) adjacent to the UGA codon has been identified in this gene (PMID:15791204). SRE is a phylogenetically conserved stem-loop structure that stimulates readthrough at the UGA codon, and augments the Sec insertion efficiency by SECIS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (2) contains an additional in-frame, Alu-derived coding exon in the 5' region compared to variant 1. The encoded isoform (2) is longer than isoform 1, containing two potential selenocysteine (Sec) residues. The first Sec found in the novel exon is not conserved, while the second Sec is highly conserved. Expression of isoform 2 was not detected in vivo or in transfection studies, leaving open the possibility that the UGA codon in the novel exon may be recognized as a stop codon, and not as a Sec codon (PMID:12700173). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217524 | SEPN1 (Myc-DDK-tagged)-Human selenoprotein N, 1 (SEPN1), transcript variant 1, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 4560.00 |
|
| RG217524 | SEPN1 (GFP-tagged) - Human selenoprotein N, 1 (SEPN1), transcript variant 1, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 5040.00 |
