Muted (BLOC1S5) (NM_201280) Human Untagged Clone
CAT#: SC309808
BLOC1S5 (untagged)-Human muted homolog (mouse) (MUTED), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BLOS5; HPS11; MU; MUTED |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309808 representing NM_201280.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTGGCGGAGGGACAGAGACCCCTGTGGGTTGTGAGGCCGCCCCGGGCGGTGGCAGCAAGAAGAGG GACTCCCTGGGGACTGCGGGCTCAGCGCACCTCATTATCAAGGATCTTGGAGAAATTCATTCAAGGCTT TTGGATCACAGACCAGTTATTCAAGGTGAAACTCGTTATTTTGTAAAAGAATTTGAAGAAAAACGTGGT CTTCGAGAAATGCGAGTTCTTGAAAATTTGAAGAACATGATCCATGAAACAAATGAACATACTCTTCCC AAATGTAGAGACACAATGCGGGACAGCCTCAGCCAGGTTCTCCAGAGATTGCAAGCAGCTAATGACTCA GTCTGTAGACTCCAACAGAGGGAACAGGAACGAAAAAAGATTCATAGTGACCACTTAGTAGCTAGTGAG AAACAGCATATGCTCCAGTGGGACAACTTCATGAAGGAGCAACCCAACAAAAGGGCTGAAGTGGATGAA GAGCACAGAAAAGCCATGGAAAGGCTTAAAGAACAATATGCTGAGATGGAGAAGGACCTAGCGAAATTT TCAACCTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_201280 |
Insert Size | 564 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_201280.2 |
RefSeq Size | 2695 bp |
RefSeq ORF | 564 bp |
Locus ID | 63915 |
UniProt ID | Q8TDH9 |
MW | 21.6 kDa |
Gene Summary | This gene encodes a component of BLOC-1 (biogenesis of lysosome-related organelles complex 1). Components of this complex are involved in the biogenesis of organelles such as melanosomes and platelet-dense granules. A mouse model for Hermansky-Pudlak Syndrome is mutated in the murine version of this gene. Alternative splicing results in multiple transcript variants. Read-through transcription exists between this gene and the upstream EEF1E1 (eukaryotic translation elongation factor 1 epsilon 1) gene, as well as with the downstream TXNDC5 (thioredoxin domain containing 5) gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221922 | BLOC1S5 (Myc-DDK-tagged)-Human muted homolog (mouse) (MUTED), transcript variant 1 |
CNY 2400.00 |
|
RC221922L3 | Lenti ORF clone of Human muted homolog (mouse) (MUTED), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC221922L4 | Lenti ORF clone of Human muted homolog (mouse) (MUTED), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG221922 | BLOC1S5 (tGFP-tagged) - Human muted homolog (mouse) (MUTED), transcript variant 1 |
CNY 4000.00 |