CABYR (NM_153770) Human Untagged Clone
CAT#: SC309643
CABYR (untagged)-Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CABYRa; CABYRc; CABYRc/d; CABYRe; CBP86; CT88; FSP-2; FSP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309643 representing NM_153770.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTTCTTCAAAGCCCAGACTTGTCGTACCCTATGGCCTCAAGACTCTGCTCGAGGGAATTAGCAGA GCTGTTCTCAAAACCAACCCATCAAACATCAACCAGTTTGCAGCAGCTTATTTTCAAGAACTTACTATG TATAGAGGGAATACTACTATGGATATAAAAGATCTGGTTAAACAATTTCATCAGATTAAAGTAGAGAAA TGGTCAGAAGGAACGACACCACAGAAGAAATTAGAATGTTTAAAAGAACCAGGAAAAACATCTGTAGAA TCTAAAGTACCTACCCAGATGGAAAAATCTACAGACACAGACGAGGACAATGTAACCAGAACAGAATAT AGTGACAAAACCACCCAGTTTCCATCAGTTTATGCTGTGCCAGGCACTGAGCAAACGGAAGCAGTTGGT GGTCTTTCTTCCAAACCAGCCACCCCTAAGACTACTACCCCACCCTCATCACCACCTCCAACAGCTGTC TCACCAGAGTTTGCCTACGTCCCAGCTGACCCAGCTCAGCTTGCTGCTCAGATGTTAGAAGATGTAGCT AAAAAAAGTTCAGGATCTGGTGACAAATGTGCTCCCTTTGGAAGTTACGGTATTGCTGGGGAGGTAACC GTGACTACTGCTCACAAACGTCGCAAAGCAGAAACTGAAAACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_153770 |
Insert Size | 666 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_153770.2 |
RefSeq Size | 951 bp |
RefSeq ORF | 666 bp |
Locus ID | 26256 |
UniProt ID | O75952 |
MW | 24 kDa |
Gene Summary | To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (6) has a alternate splice junction in the coding region, which results in a downstream translation stop codon, compared to variant 1. The encoded isoform (e) is shorter and has a distinct C-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219448 | CABYR (Myc-DDK-tagged)-Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6 |
CNY 2400.00 |
|
RC219448L1 | Lenti ORF clone of Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6, Myc-DDK-tagged |
CNY 4800.00 |
|
RC219448L2 | Lenti ORF clone of Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RC219448L3 | Lenti ORF clone of Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6, Myc-DDK-tagged |
CNY 5890.00 |
|
RC219448L4 | Lenti ORF clone of Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RG219448 | CABYR (tGFP-tagged) - Human calcium binding tyrosine-(Y)-phosphorylation regulated (CABYR), transcript variant 6 |
CNY 4370.00 |