CABP (CABP1) (NM_031205) Human Untagged Clone

CAT#: SC309599

CABP1 (untagged)-Human calcium binding protein 1 (CABP1), transcript variant 1



  "NM_031205" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CABP1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CALBRAIN; HCALB_BR
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309599 representing NM_031205.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCAACTGTGTCAAGTATCCACTGAGAAATCTCTCAAGGAAGATGTGCCAGGAGGAACAGACCAGC
TACATGGTGGTGCAGACGAGCGAGGAGGGGCTGGCGGCTGACGCCGAGCTCCCGGGACCGCTCCTGATG
CTGGCCCAGAACTGCGCAGTCATGCACAACCTGCTGGGCCCTGCCTGCATTTTCCTGCGCAAGGGCTTC
GCTGAGAACAGGCAGCCTGATAGATCACTGCGACCAGAGGAAATTGAAGAGCTCCGAGAGGCCTTCAGA
GAATTCGACAAGGACAAGGATGGCTACATCAACTGCCGGGATCTGGGCAACTGCATGCGCACCATGGGC
TACATGCCCACCGAGATGGAGCTCATCGAACTGTCCCAGCAGATCAACATGAACCTGGGTGGCCATGTA
GATTTTGATGACTTCGTGGAGCTAATGGGGCCTAAACTCCTGGCAGAGACAGCAGATATGATTGGTGTA
AAGGAACTGCGAGATGCTTTCCGAGAGTTTGACACCAATGGTGATGGGGAAATAAGCACCAGTGAGCTG
CGAGAGGCTATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGAGACATAGAGGAAATTATCCGAGAT
GTGGACCTCAATGGGGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCCCGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_031205
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_031205.3
RefSeq Size 1262 bp
RefSeq ORF 684 bp
Locus ID 9478
UniProt ID Q9NZU7
Domains EFh
MW 26 kDa
Gene Summary Calcium binding proteins are an important component of calcium mediated cellular signal transduction. This gene encodes a protein that belongs to a subfamily of calcium binding proteins which share similarity to calmodulin. The protein encoded by this gene regulates the gating of voltage-gated calcium ion channels. This protein inhibits calcium-dependent inactivation and supports calcium-dependent facilitation of ion channels containing voltage-dependent L-type calcium channel subunit alpha-1C. This protein also regulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors, P/Q-type voltage-gated calcium channels, and transient receptor potential channel TRPC5. This gene is predominantly expressed in retina and brain. Alternative splicing results in multiple transcript variants encoding disinct isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) has an alternate 5' sequence, as compared to variant 3. The encoded isoform 1 has a distinct and shorter N-terminus, as compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...