CABP (CABP1) (NM_031205) Human Untagged Clone
CAT＃: SC309599
CABP1 (untagged)-Human calcium binding protein 1 (CABP1), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CALBRAIN; HCALB_BR |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC309599 representing NM_031205.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCAACTGTGTCAAGTATCCACTGAGAAATCTCTCAAGGAAGATGTGCCAGGAGGAACAGACCAGC TACATGGTGGTGCAGACGAGCGAGGAGGGGCTGGCGGCTGACGCCGAGCTCCCGGGACCGCTCCTGATG CTGGCCCAGAACTGCGCAGTCATGCACAACCTGCTGGGCCCTGCCTGCATTTTCCTGCGCAAGGGCTTC GCTGAGAACAGGCAGCCTGATAGATCACTGCGACCAGAGGAAATTGAAGAGCTCCGAGAGGCCTTCAGA GAATTCGACAAGGACAAGGATGGCTACATCAACTGCCGGGATCTGGGCAACTGCATGCGCACCATGGGC TACATGCCCACCGAGATGGAGCTCATCGAACTGTCCCAGCAGATCAACATGAACCTGGGTGGCCATGTA GATTTTGATGACTTCGTGGAGCTAATGGGGCCTAAACTCCTGGCAGAGACAGCAGATATGATTGGTGTA AAGGAACTGCGAGATGCTTTCCGAGAGTTTGACACCAATGGTGATGGGGAAATAAGCACCAGTGAGCTG CGAGAGGCTATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGAGACATAGAGGAAATTATCCGAGAT GTGGACCTCAATGGGGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCCCGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_031205 |
| Insert Size | 684 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_031205.3 |
| RefSeq Size | 1262 bp |
| RefSeq ORF | 684 bp |
| Locus ID | 9478 |
| UniProt ID | Q9NZU7 |
| Domains | EFh |
| MW | 26 kDa |
| Gene Summary | Calcium binding proteins are an important component of calcium mediated cellular signal transduction. This gene encodes a protein that belongs to a subfamily of calcium binding proteins which share similarity to calmodulin. The protein encoded by this gene regulates the gating of voltage-gated calcium ion channels. This protein inhibits calcium-dependent inactivation and supports calcium-dependent facilitation of ion channels containing voltage-dependent L-type calcium channel subunit alpha-1C. This protein also regulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors, P/Q-type voltage-gated calcium channels, and transient receptor potential channel TRPC5. This gene is predominantly expressed in retina and brain. Alternative splicing results in multiple transcript variants encoding disinct isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) has an alternate 5' sequence, as compared to variant 3. The encoded isoform 1 has a distinct and shorter N-terminus, as compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218317 | CABP1 (Myc-DDK-tagged)-Human calcium binding protein 1 (CABP1), transcript variant 1 |
CNY 2400.00 |
|
| RC218317L3 | Lenti ORF clone of Human calcium binding protein 1 (CABP1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218317L4 | Lenti ORF clone of Human calcium binding protein 1 (CABP1), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG218317 | CABP1 (tGFP-tagged) - Human calcium binding protein 1 (CABP1), transcript variant 1 |
CNY 4370.00 |
