MEK7 (MAP2K7) (NM_145185) Human Untagged Clone
CAT#: SC309544
MAP2K7 (untagged)-Human mitogen-activated protein kinase kinase 7 (MAP2K7)
CNY 3656.00
CNY 6750.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JNKK2; MAPKK7; MEK; MEK 7; MKK7; PRKMK7; SAPKK-4; SAPKK4 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_145185 edited
GGTACCGATGGCGGCGTCCTCCCTGGAACAGAAGCTGTCCCGCCTGGAAGCAAAGCTGAA GCAGGAGAACCGGGAGGCCCGGCGGAGGATCGACCTCAACCTGGATATCAGCCCCCAGCG GCCCAGGCCCACCCTGCAGCTCCCGCTGGCCAACGATGGGGGCAGCCGCTCGCCATCCTC AGAGAGCTCCCCGCAGCACCCCACGCCCCCCGCCCGGCCCCGCCACATGCTGGGGCTCCC GTCAACCCTGTTCACACCCCGCAGCATGGAGAGCATTGAGATTGACCAGAAGCTGCAGGA GATCATGAAGCAGACGGGCTACCTGACCATCGGGGGCCAGCGCTACCAGGCAGAAATCAA CGACCTGGAGAACTTGGGCGAGATGGGCAGCGGCACCTGCGGCCAGGTGTGGAAGATGCG CTTCCGGAAGACCGGCCACGTCATTGCCGTTAAGCAAATGCGGCGCTCCGGGAACAAGGA GGAGAACAAGCGCATCCTCATGGACCTGGATGTGGTGCTGAAGAGCCACGACTGCCCCTA CATCGTGCAGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCT CATGGGCACCTGCGCTGAGAAGCTCAAGAAGCGGATGCAGGGCCCCATCCCCGAGCGCAT TCTGGGCAAGATGACAGTGGCGATTGTGAAGGCGCTGTACTACCTGAAGGAGAAGCACGG TGTCATCCACCGCGACGTCAAGCCCTCCAACATCCTGCTGGACGAGCGGGGCCAGATCAA GCTCTGCGACTTCGGCATCAGCGGCCGCCTGGTGGACTCCAAAGCCAAGACGCGGAGCGC CGGCTGTGCCGCCTACATGGCACCCGAGCGCATTGACCCCCCAGACCCCACCAAGCCGGA CTATGACATCCGGGCCGACGTATGGAGCCTGGGCATCTCGTTGGTGGAGCTGGCAACAGG ACAGTTTCCCTACAAGAACTGCAAGACGGACTTTGAGGTCCTCACCAAAGTCCTACAGGA AGAGCCCCCGCTTCTGCCCGGACACATGGGCTTCTCGGGGGACTTCCAGTCCTTCGTCAA AGACTGCCTTACTAAAGATCACAGGAAGAGACCAAAGTATAATAAGCTACTTGAACACAG CTTCATCAAGCGCTACGAGACGCTGGAGGTGGACGTGGCGTCCTGGTTCAAGGATGTCAT GGCGAAGACTGAGTCACCGCGGACTAGCGGCGTCCTGAGCCAGCCCCACCTGCCCTTCTT CAGGTAGCTGCTTGGTCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_145185 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_145185.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_145185.2, NP_660186.1 |
RefSeq Size | 3386 bp |
RefSeq ORF | 1260 bp |
Locus ID | 5609 |
UniProt ID | O14733 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | ErbB signaling pathway, Fc epsilon RI signaling pathway, GnRH signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell responses to proinflammatory cytokines, and environmental stresses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform 3, which lacks an internal segment and is shorter, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213868 | MAP2K7 (Myc-DDK-tagged)-Human mitogen-activated protein kinase kinase 7 (MAP2K7) |
CNY 3656.00 |
|
RC213868L1 | Lenti ORF clone of Human mitogen-activated protein kinase kinase 7 (MAP2K7), Myc-DDK-tagged |
CNY 6056.00 |
|
RC213868L2 | Lenti ORF clone of Human mitogen-activated protein kinase kinase 7 (MAP2K7), mGFP tagged |
CNY 6056.00 |
|
RC213868L3 | Lenti ORF clone of Human mitogen-activated protein kinase kinase 7 (MAP2K7), Myc-DDK-tagged |
CNY 5890.00 |
|
RC213868L4 | Lenti ORF clone of Human mitogen-activated protein kinase kinase 7 (MAP2K7), mGFP tagged |
CNY 5890.00 |
|
RG213868 | MAP2K7 (tGFP-tagged) - Human mitogen-activated protein kinase kinase 7 (MAP2K7) |
CNY 5256.00 |