P2Y2 (P2RY2) (NM_176071) Human Untagged Clone

CAT#: SC309531

P2RY2 (untagged)-Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3



  "NM_176071" in other vectors (6)

CNY 6180.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-P2RY2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HP2U; P2RU1; P2U; P2U1; P2UR; P2Y2; P2Y2R
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309531 representing NM_176071.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGCACCTGGGATGGGGATGAGCTGGGCTAC
AGGTGCCGCTTCAACGAGGACTTCAAGTACGTGCTGCTGCCTGTGTCCTACGGCGTGGTGTGCGTGCTT
GGGCTGTGTCTGAACGCCGTGGCGCTCTACATCTTCTTGTGCCGCCTCAAGACCTGGAATGCGTCCACC
ACATATATGTTCCACCTGGCTGTGTCTGATGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTAC
TACGCCCGCGGCGACCACTGGCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTACACC
AACCTTTACTGCAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGCGTCTTACGACCT
CTGCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCCGGGGCCGTGTGGGTGTTGGTG
CTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACCAGCGCGCGCGGGGGCCGCGTAACCTGCCAC
GACACCTCGGCACCCGAGCTCTTCAGCCGCTTCGTGGCCTACAGCTCAGTCATGCTGGGCCTGCTCTTC
GCGGTGCCCTTTGCCGTCATCCTTGTCTGTTACGTGCTCATGGCTCGGCGACTGCTAAAGCCAGCCTAC
GGGACCTCGGGCGGCCTGCCTAGGGCCAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTC
TTCGCCCTCTGCTTCCTGCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTGGACCTC
AGCTGCCACACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTGGCCAGTGCTAACAGT
TGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTACGCTTTGCCCGAGATGCCAAGCCA
CCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGCAGGCTGGGCCTGCGCAGATCCGACAGAACTGAC
ATGCAGAGGATAGAAGATGTGTTGGGCAGCAGTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGT
AGCGAGAACACTAAGGACATTCGGCTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_176071
Insert Size 1134 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_176071.2
RefSeq Size 8667 bp
RefSeq ORF 1134 bp
Locus ID 5029
UniProt ID P41231
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
MW 42.3 kDa
Gene Summary The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Transcript variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...