P2Y2 (P2RY2) (NM_176071) Human Untagged Clone
CAT#: SC309531
P2RY2 (untagged)-Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3
CNY 6180.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HP2U; P2RU1; P2U; P2U1; P2UR; P2Y2; P2Y2R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309531 representing NM_176071.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGCACCTGGGATGGGGATGAGCTGGGCTAC AGGTGCCGCTTCAACGAGGACTTCAAGTACGTGCTGCTGCCTGTGTCCTACGGCGTGGTGTGCGTGCTT GGGCTGTGTCTGAACGCCGTGGCGCTCTACATCTTCTTGTGCCGCCTCAAGACCTGGAATGCGTCCACC ACATATATGTTCCACCTGGCTGTGTCTGATGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTAC TACGCCCGCGGCGACCACTGGCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTACACC AACCTTTACTGCAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGCGTCTTACGACCT CTGCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCCGGGGCCGTGTGGGTGTTGGTG CTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACCAGCGCGCGCGGGGGCCGCGTAACCTGCCAC GACACCTCGGCACCCGAGCTCTTCAGCCGCTTCGTGGCCTACAGCTCAGTCATGCTGGGCCTGCTCTTC GCGGTGCCCTTTGCCGTCATCCTTGTCTGTTACGTGCTCATGGCTCGGCGACTGCTAAAGCCAGCCTAC GGGACCTCGGGCGGCCTGCCTAGGGCCAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTC TTCGCCCTCTGCTTCCTGCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTGGACCTC AGCTGCCACACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTGGCCAGTGCTAACAGT TGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTACGCTTTGCCCGAGATGCCAAGCCA CCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGCAGGCTGGGCCTGCGCAGATCCGACAGAACTGAC ATGCAGAGGATAGAAGATGTGTTGGGCAGCAGTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGT AGCGAGAACACTAAGGACATTCGGCTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_176071 |
Insert Size | 1134 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_176071.2 |
RefSeq Size | 8667 bp |
RefSeq ORF | 1134 bp |
Locus ID | 5029 |
UniProt ID | P41231 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
MW | 42.3 kDa |
Gene Summary | The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Transcript variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223878 | P2RY2 (Myc-DDK-tagged)-Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3 |
CNY 3656.00 |
|
RC223878L1 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3, Myc-DDK-tagged |
CNY 6056.00 |
|
RC223878L2 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RC223878L3 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC223878L4 | Lenti ORF clone of Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG223878 | P2RY2 (tGFP-tagged) - Human purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), transcript variant 3 |
CNY 4370.00 |