Caspase 1 (CASP1) (NM_033294) Human Untagged Clone

CAT#: SC309463

CASP1 (untagged)-Human caspase 1, apoptosis-related cysteine peptidase (interleukin 1, beta, convertase) (CASP1), transcript variant delta



  "NM_033294" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse Monoclonal Caspase-1 Antibody (14F468)
    • 100 ug

CNY 6,056.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ICE; IL1BC; P45
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF sequence for NM_033294 edited
ATGGCCGACAAGGTCCTGAAGGAGAAGAGAAAGCTGTTTATCCGTTCCATGGGTGAAGCT
CCTCAGGCAGTGCAGGACAACCCAGCTATGCCCACATCCTCAGGCTCAGAAGGGAATGTC
AAGCTTTGCTCCCTAGAAGAAGCTCAAAGGATATGGAAACAAAAGTCGGCAGAGATTTAT
CCAATAATGGACAAGTCAAGCCGCACACGTCTTGCTCTCATTATCTGCAATGAAGAATTT
GACAGTATTCCTAGAAGAACTGGAGCTGAGGTTGACATCACAGGCATGACAATGCTGCTA
CAAAATCTGGGGTACAGCGTAGATGTGAAAAAAAATCTCACTGCTTCGGACATGACTACA
GAGCTGGAGGCATTTGCACACCGCCCAGAGCACAAGACCTCTGACAGCACGTTCCTGGTG
TTCATGTCTCATGGTATTCGGGAAGGCATTTGTGGGAAGAAACACTCTGAGCAAGTCCCA
GATATACTACAACTCAATGCAATCTTTAACATGTTGAATACCAAGAACTGCCCAAGTTTG
AAGGACAAACCGAAGGTGATCATCATCCAGGCCTGCCGTGGTGATAATGTTTCTTGGAGA
CATCCCACAATGGGCTCTGTTTTTATTGGAAGACTCATTGAACATATGCAAGAATATGCC
TGTTCCTGTGATGTGGAGGAAATTTTCCGCAAGGTTCGATTTTCATTTGAGCAGCCAGAT
GGTAGAGCGCAGATGCCCACCACTGAAAGAGTGACTTTGACAAGATGTTTCTACCTCTTC
CCAGGACATTAA
Restriction Sites Please inquire     
ACCN NM_033294
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033294.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033294.2, NP_150636.1
RefSeq Size 941 bp
RefSeq ORF 792 bp
Locus ID 834
UniProt ID P29466
Protein Families Druggable Genome, Protease
Protein Pathways Amyotrophic lateral sclerosis (ALS), Cytosolic DNA-sensing pathway, NOD-like receptor signaling pathway
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
Transcript Variant: This variant (delta) has multiple differences in the coding region but the translation remains in frame, compared to variant alpha. Variant delta encodes a protein lacking two internal segments, compared to the isoform alpha. Isoform delta lacks apoptosis-inducing activity. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...