CD95 (FAS) (NM_152872) Human Untagged Clone
CAT#: SC309447
FAS (untagged)-Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 3
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALPS1A; APO-1; APT1; CD95; FAS1; FASTM; TNFRSF6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_152872, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCC AAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACT GTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTGCATCATGATGGCCAATTCTGCCAT AAGCCCTGTCCTCCAGGTGAAAGGAAAGCTAGGGACTGCACAGTCAATGGGGATGAACCA GACTGCGTGCCCTGCCAAGAAGGGAAGGAGTACACAGACAAAGCCCATTTTTCTTCCAAA TGCAGAAGATGTAGATTGTGTGATGAAGGACATGGCTTAGAAGTGGAAATAAACTGCACC CGGACCCAGAATACCAAGTGCAGATGTAAACCAAACTTTTTTTGTAACTCTACTGTATGT GAACACTGTGACCCTTGCACCAAATGTGAACATGGAATCATCAAGGAATGCACACTCACC AGCAACACCAAGTGCAAAGAGGAAGGATCCAGATCTAACTTGGGGTGGCTTTGTCTTCTT CTTTTGCCAATTCCACTAATTGTTTGGGTGAAGAGAAAGGAAGTACAGAAAACATGCAGA AAGCACAGAAAGGAAAACCAAGGTTCTCATGAATCTCCAACCTTAAATCCTATGTTGACT TGA |
Restriction Sites | Please inquire |
ACCN | NM_152872 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_152872.1, NP_690611.1 |
RefSeq Size | 2730 bp |
RefSeq ORF | 2730 bp |
Locus ID | 355 |
UniProt ID | P25445 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Allograft rejection, Alzheimer's disease, Apoptosis, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Graft-versus-host disease, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, p53 signaling pathway, Pathways in cancer, Type I diabetes mellitus |
Gene Summary | The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (3), also known as FASExo8Del, lacks a coding segment, which leads to a translation frameshift, compared to variant 1. The resulting isoform (3) contains a distinct and shorter C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211622 | FAS (Myc-DDK-tagged)-Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 3 |
CNY 3990.00 |
|
RC211622L3 | Lenti-ORF clone of FAS (Myc-DDK-tagged)-Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 3 |
CNY 5890.00 |
|
RC211622L4 | Lenti-ORF clone of FAS (mGFP-tagged)-Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 3 |
CNY 5890.00 |
|
RG211622 | FAS (tGFP-tagged) - Human Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 3 |
CNY 5440.00 |