PSMC3IP (NM_013290) Human Untagged Clone
CAT＃: SC309418
PSMC3IP (untagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GT198; HOP2; HUMGT198A; ODG3; TBPIP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC309418 representing NM_013290.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTAAAGGCCGGGCAGAAGCTGCGGCGGGAGCCGCCGGGATCCTCCTGAGGTACCTGCAGGAGCAG AACCGGCCCTACAGCTCCCAGGATGTGTTCGGGAACCTACAGCGGGAACACGGACTGGGCAAGGCGGTG GTGGTGAAGACGCTGGAGCAGCTGGCGCAACAAGGCAAGATCAAAGAGAAGATGTACGGCAAGCAGAAG ATCTATTTTGCGGATCAGGACCAGTTTGACATGGTGAGTGATGCTGACCTTCAAGTCCTAGATGGCAAA ATCGTGGCCCTCACTGCTAAGGTGCAGAGCTTGCAGCAGAGCTGCCGCTACATGGAGGCTGAGATGCAG AAAGAAATCCAGGAGTTAAAGAAGGAATGCGCTGGCTACAGAGAGAGATTGAAGAACATTAAAGCAGCT ACCAATCATGTGACTCCAGAAGAGAAAGAGCAGGTGTACAGAGAGAGGCAGAAGTACTGTAAGGAGTGG AGGAAGAGGAAGAGGATGGCTACAGAGCTGTCTGATGCAATACTTGAAGGATACCCCAAGAGCAAGAAG CAGTTCTTTGAGGAAGTTGGGATAGAGACGGATGAAGATTACAACGTCACACTCCCAGACCCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_013290 |
| Insert Size | 618 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013290.6 |
| RefSeq Size | 1440 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 29893 |
| UniProt ID | Q9P2W1 |
| Protein Families | Druggable Genome |
| MW | 23.6 kDa |
| Gene Summary | This gene encodes a protein that functions in meiotic recombination. It is a subunit of the PSMC3IP/MND1 complex, which interacts with PSMC3/TBP1 to stimulate DMC1- and RAD51-mediated strand exchange during meiosis. The protein encoded by this gene can also co-activate ligand-driven transcription mediated by estrogen, androgen, glucocorticoid, progesterone, and thyroid nuclear receptors. Mutations in this gene cause XX female gonadal dysgenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1) uses an alternate in-frame splice site in the central coding region, compared to variant 2, resulting in an isoform (1) that is shorter than isoform 2. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201045 | PSMC3IP (Myc-DDK-tagged)-Human PSMC3 interacting protein (PSMC3IP), transcript variant 1 |
CNY 2400.00 |
|
| RC201045L3 | Lenti ORF clone of Human PSMC3 interacting protein (PSMC3IP), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC201045L4 | Lenti ORF clone of Human PSMC3 interacting protein (PSMC3IP), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG201045 | PSMC3IP (tGFP-tagged) - Human PSMC3 interacting protein (PSMC3IP), transcript variant 1 |
CNY 4370.00 |
其它PSMC3IP产品
