PAX3 (NM_181459) Human Untagged Clone

CAT#: SC309287

PAX3 (untagged)-Human paired box 3 (PAX3), transcript variant PAX3E



  "NM_181459" in other vectors (4)

CNY 8080.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
PAX3 mouse monoclonal antibody,clone OTI4D1
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDHS; HUP2; WS1; WS3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309287 representing NM_181459.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGC
GGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGTGTTTTTATC
AACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGATCGTGGAGATGGCCCACCACGGCATCCGGCCC
TGCGTCATCTCGCGCCAGCTGCGCGTGTCCCACGGCTGCGTCTCCAAGATCCTGTGCAGGTACCAGGAG
ACTGGCTCCATACGTCCTGGTGCCATCGGCGGCAGCAAGCCCAAGCAGGTGACAACGCCTGACGTGGAG
AAGAAAATTGAGGAATACAAAAGAGAGAACCCGGGCATGTTCAGCTGGGAAATCCGAGACAAATTACTC
AAGGACGCGGTCTGTGATCGAAACACCGTGCCGTCAGTGAGTTCCATCAGCCGCATCCTGAGAAGTAAA
TTCGGGAAAGGTGAAGAGGAGGAGGCCGACTTGGAGAGGAAGGAGGCAGAGGAAAGCGAGAAGAAGGCC
AAACACAGCATCGACGGCATCCTGAGCGAGCGAGCCTCAGCACCCCAATCAGATGAAGGCTCTGATATT
GACTCTGAACCAGATTTACCACTAAAGAGGAAACAGCGCAGAAGCCGAACCACCTTCACAGCAGAACAG
CTGGAGGAACTGGAGCGTGCTTTTGAGAGAACTCATTACCCTGACATTTATACTAGGGAGGAACTGGCC
CAGAGGGCGAAGCTCACCGAGGCCCGAGTACAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAG
CAAGCTGGGGCCAATCAACTGATGGCTTTCAACCATCTCATTCCCGGGGGGTTCCCTCCCACTGCCATG
CCGACCTTGCCAACGTACCAGCTGTCGGAGACCTCTTACCAGCCCACATCTATTCCACAAGCTGTGTCA
GATCCCAGCAGCACCGTTCACAGACCTCAACCGCTTCCTCCAAGCACTGTACACCAAAGCACGATTCCT
TCCAACCCAGACAGCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCCAGCTATACAGAC
AGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATGAACCCCACCATTGGCAATGGCCTCTCACCTCAG
GTAATGGGACTCCTGACCAACCACGGTGGGGTACCTCATCAGCCCCAGACTGATTACGCGCTCTCCCCT
CTCACCGGGGGTCTGGAACCTACCACCACGGTGTCGGCCAGCTGCAGTCAGAGACTAGACCATATGAAG
AGCTTGGACAGTCTGCCAACATCTCAGTCCTACTGTCCACCCACCTATAGCACCACAGGCTACAGTATG
GACCCTGTCACAGGCTACCAATATGGGCAGTATGGACAAAGTGCCTTTCATTATCTCAAGCCAGATATC
GCTTGGTTTCAAATCCTTTTGAACACGTTCGACAAAAGCAGTGGAGAAGAGGAAGACCTGGAGCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181459
Insert Size 1518 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181459.3
RefSeq Size 3188 bp
RefSeq ORF 1518 bp
Locus ID 5077
UniProt ID P23760
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors
MW 56 kDa
Gene Summary This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (PAX3E) differs in the 3' UTR, and contains an alternate splice pattern in the 3' coding region, compared to variant PAX3. The resulting protein (isoform PAX3e) is longer and has a distinct C-terminus, compared to isoform PAX3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...