ASB6 (NM_177999) Human Untagged Clone
CAT#: SC309257
ASB6 (untagged)-Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309257 representing NM_177999.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCGTTCCTGCACGGCTTCCGGAGGATCATCTTCGAGTACCAGCCGCTGGTGGATGCGATTCTGGGC TCCCTGGGGATCCAGGACCCCGAGCGGCAGGAGTCTCTGGACCGGCCCAGTTATGTCGCCAGCGAGGAG AGCCGAATCCTTGTTCTCACTGAGCTGCTGGAGAGGAAAGCCCACTCTCCCTTTTACCAGGAAGGCGTG AGCAACGCCCTGCTCAAGATGGCTGAGCTGGGGCTGACGCGGGCGGCCGACGTTCTCTTGCGGCATGGG GCCAATCTCAACTTTGAAGACCCAGTCACCTACTACACGGCCTTGCACATCGCCGTCCTGCGGAACCAG CCGGACATGGTGGAGCTGCTGGTGCATCACGGGGCCGACGTTAATCGGAGGGACCGGGAAAAACTGCTC TGCTCCATGCTCTGGCCAGCAGCGACGGGGTGCAGATCCACAATACTGAGAACATTCGTCTCTTACTGG AAGGAGGGGCAGACGTCAAGGCCACCACCAAAGATGGGGACACAGTGTTCACCTGCATCATCTTCCTGC TTGGTGAGACCGTGGGAGGGGACAAAGAGGAGGCCCAGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_177999 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_177999.2 |
RefSeq Size | 4548 bp |
RefSeq ORF | 594 bp |
Locus ID | 140459 |
UniProt ID | Q9NWX5 |
Protein Families | Druggable Genome |
MW | 22.4 kDa |
Gene Summary | The protein encoded by this gene belongs to a family of ankyrin repeat proteins that, along with four other protein families, contain a C-terminal SOCS box motif. Growing evidence suggests that the SOCS box, similar to the F-box, acts as a bridge between specific substrate-binding domains and the more generic proteins that comprise a large family of E3 ubiquitin protein ligases. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a unique C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215887 | ASB6 (Myc-DDK-tagged)-Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2 |
CNY 2400.00 |
|
RC215887L1 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC215887L2 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC215887L3 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215887L4 | Lenti ORF clone of Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG215887 | ASB6 (tGFP-tagged) - Human ankyrin repeat and SOCS box containing 6 (ASB6), transcript variant 2 |
CNY 4370.00 |