FBXO36 (NM_174899) Human Untagged Clone
CAT#: SC309212
FBXO36 (untagged)-Human F-box protein 36 (FBXO36)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | Fbx36 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309212 representing NM_174899.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGTCGTGGCTGCCGGAGACTCTCTTTGAAACTGTAGGACAAGGCCCGCCGCCTAGCAAAGACTAT TACCAGTTACTGGTCACCCGGTCTCAGGTAATCTTTAGATGGTGGAAGATCTCTCTAAGGAGTGAGTAT CGATCAACAAAACCTGGAGAAGCAAAAGAAACCCATGAAGACTTCCTAGAGAATTCACATCTTCAAGGT CAAACTGCCTTAATATTTGGTGCAAGAATATTAGACTATGTCATCAATTTGTGCAAAGGTAAATTTGAC TTCCTTGAACGGCTCTCAGACGATTTGCTCCTGACTATCATTTCTTATCTGGATCTTGAAGATATTGCC AGGCTTTGTCAAACATCACACAGATTTGCAAAGCTGTGCATGTCTGATAAACTGTGGGAACAGATAGTC CAGTCGACCTGCGACACCATCACTCCTGACGTGAGGGCCCTGGCGGAGGACACAGGCTGGAGACAGCTG TTCTTCACCAACAAGCTCCAGCTCCAGCGGCAGCTCCGCAAGAGGAAACAAAAATATGGAAACCTGAGA GAAAAGCAACCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_174899 |
Insert Size | 567 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_174899.4 |
RefSeq Size | 2832 bp |
RefSeq ORF | 567 bp |
Locus ID | 130888 |
UniProt ID | Q8NEA4 |
Protein Families | Druggable Genome |
MW | 22.1 kDa |
Gene Summary | Members of the F-box protein family, such as FBXO36, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222177 | FBXO36 (Myc-DDK-tagged)-Human F-box protein 36 (FBXO36) |
CNY 2400.00 |
|
RC222177L1 | Lenti ORF clone of Human F-box protein 36 (FBXO36), Myc-DDK-tagged |
CNY 4800.00 |
|
RC222177L2 | Lenti ORF clone of Human F-box protein 36 (FBXO36), mGFP tagged |
CNY 5890.00 |
|
RC222177L3 | Lenti ORF clone of Human F-box protein 36 (FBXO36), Myc-DDK-tagged |
CNY 5890.00 |
|
RC222177L4 | Lenti ORF clone of Human F-box protein 36 (FBXO36), mGFP tagged |
CNY 5890.00 |
|
RG222177 | FBXO36 (tGFP-tagged) - Human F-box protein 36 (FBXO36) |
CNY 4370.00 |