HSCB (NM_172002) Human Untagged Clone

CAT#: SC309178

HSCB (untagged)-Human HscB iron-sulfur cluster co-chaperone homolog (E. coli) (HSCB)



  "NM_172002" in other vectors (6)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HSCB mouse monoclonal antibody, clone OTI3E1 (formerly 3E1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DNAJC20; HSC20; JAC1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_172002 edited
GGCACGAGGTCTGGTTAGACGCTCTCTTTGCTTTTCCCCACGAGTGACCACGGCTAGATA
GGCCGCCGGCCAGATGTGGCGGGGGAGAGCCGGGGCTTTGCTCCGGGTGTGGGGGTTTTG
GCCGACAGGGGTTCCCAGAAGGAGACCGCTAAGCTGCGATGCTGCGTCGCAGGCGGGAAG
CAATTATCCCCGCTGTTGGAACTGCGGCGGCCCATGGGGCCCCGGGCGGGAGGACAGGTT
CTTCTGCCCACAGTGCCGAGCGCTGCAGGCACCTGACCCCACTCGAGACTACTTCAGCCT
TATGGACTGCAACCGTTCCTTCAGAGTTGATACAGCGAAGCTCCAGCACAGGTACCAGCA
ACTGCAGCGTCTTGTCCACCCAGATTTCTTCAGCCAGAGGTCTCAGACTGAAAAGGACTT
CTCAGAGAAGCATTCGACCCTGGTGAATGATGCCTATAAGACCCTCCTGGCCCCCCTGAG
CAGAGGACTGTACCTTCTAAAGCTCCATGGAATAGAGATTCCTGAAAGGACAGATTATGA
AATGGACAGGCAATTCCTCATAGAAATAATGGAAATCAATGAAAAACTCGCAGAAGCTGA
AAGTGAAGCTGCCATGAAAGAGATTGAATCCATTGTCAAAGCTAAACAGAAAGAATTTAC
TGACAATGTGAGCAGTGCTTTTGAACAAGATGACTTTGAAGAAGCCAAGGAAATTTTGAC
AAAGATGAGATACTTTTCAAATATAGAAGAAAAGATCAAGTTAAAGAAGATTCCCCTTTA
ATTGTGGATAGTTTAAAGTTTAAAAAATAAAGTTCTTGCTGGGCACAGTGGCTCACACCT
GTAATCCCAGCACTTTGGGAGGCTGAGGTGGGTGGATGACAAGGTCAGGAGTTCAAGACC
AGCTTGGCCAACATAGTGAAACCCCGTCTCTGCTGAAAATACAAAAATTAGCCGGGCATG
GTGGCGCGTGCCTGTAATCCCAGCTACTTGGTAGGCCGAGGCAGGAGAATCGCTTAAACC
CGTGAGGTGGAGGTTGCAGTGAGCAGAGATCACGCAACTGCACTCCAGCTTGGGCAACAG
AGTGAGACTTAATCTTGAAAAATAAATAAATGAAAAATAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_172002
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_172002.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172002.3, NP_741999.3
RefSeq Size 1106 bp
RefSeq ORF 708 bp
Locus ID 150274
UniProt ID Q8IWL3
Gene Summary This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...