Nurim (NRM) (NM_007243) Human Untagged Clone
CAT#: SC309157
NRM (untagged)-Human nurim (nuclear envelope membrane protein) (NRM)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NRM29 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_007243 edited
ATGGCCCCTGCACTGCTCCTGATCCCTGCTGCCCTCGCCTCTTTCATCCTGGCCTTTGGC ACCGGAGTGGAGTTCGTGCGCTTTACCTCCCTTCGGCCACTTCTTGGAGGGATCCCGGAG TCTGGTGGTCCGGATGCCCGCCAGGGATGGCTGGCTGCCCTGCAGGACCGCAGCATCCTT GCCCCCCTGGCATGGGATCTGGGGCTCCTGCTTCTATTTGTTGGGCAGCACAGCCTCATG GCAGCTGAAAGAGTGAAGGCATGGACATCCCGGTACTTTGGGGTCCTTCAGAGGTCACTG TATGTGGCCTGCACTGCCCTGGCCTTGCAGCTGGTGATGCGGTACTGGGAGCCCATACCC AAAGGCCCTGTGTTGTGGGAGGCTCGGGCTGAGCCATGGGCCACCTGGGTGCCGCTCCTC TGCTTTGTGCTCCATGTCATCTCCTGGCTCCTCATCTTTAGCATCCTTCTCGTCTTTGAC TATGCTGAGCTCATGGGCCTCAAACAGGTATACTACCATGTGCTGGGGCTGGGCGAGCCT CTGGCCCTGAAGTCTCCCCGGGCTCTCAGACTCTTCTCCCACCTGCGCCACCCAGTGTGT GTGGAGCTGCTGACAGTGCTGTGGGTGGTGCCTACCCTGGGCACGGACCGTCTCCTCCTT GCTTTCCTCCTTACCCTCTACCTGGGCCTGGCTCACGGGCTTGATCAGCAAGACCTCCGC TACCTCCGGGCCCAGCTACAAAGAAAACTCCACCTGCTCTCTCGGCCCCAGGATGGGGAG GCAGAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_007243 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_007243.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007243.1, NP_009174.1 |
RefSeq Size | 1433 bp |
RefSeq ORF | 789 bp |
Locus ID | 11270 |
UniProt ID | Q8IXM6 |
Protein Families | Transmembrane |
Gene Summary | The protein encoded by this gene contains transmembrane domains and resides within the inner nuclear membrane, where it is tightly associated with the nucleus. This protein shares homology with isoprenylcysteine carboxymethyltransferase enzymes. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208090 | NRM (Myc-DDK-tagged)-Human nurim (nuclear envelope membrane protein) (NRM) |
CNY 2400.00 |
|
RC208090L3 | Lenti ORF clone of Human nurim (nuclear envelope membrane protein) (NRM), Myc-DDK-tagged |
CNY 5890.00 |
|
RC208090L4 | Lenti ORF clone of Human nurim (nuclear envelope membrane protein) (NRM), mGFP tagged |
CNY 5890.00 |
|
RG208090 | NRM (tGFP-tagged) - Human nurim (nuclear envelope membrane protein) (NRM) |
CNY 4000.00 |