COP (CARD16) (NM_052889) Human Untagged Clone
CAT#: SC309071
CARD16 (untagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | COP; COP1; PSEUDO-ICE |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_052889 edited
ATCTGGTACCGGTCCGGAATTCCCGGGATGAGAAAAGCCATGGCCGACAAGGTCCTGAAG GAGAAGAGAAAGCTGTTTATCCATTCCATGGGTGAAGGTACAATAAATGGCTTACTGGAT GAATTATTACAGACAAGGGTGCTGAACCAGGAAGAGATGGAGAAAGTAAAACGTGAAAAT GCTACAGTTATGGATAAGACCCGAGCTTTGATTGACTCCGTTATTCCGAAAGGGGCACAG GCATGCCAAATTTGCATCACATACATTTGTGAAGAAGACAGTTACCTGGCAGAGACGCTG GGACTCTCAGCAGGTCCGATACCTGGAAATTAG |
Restriction Sites | Please inquire |
ACCN | NM_052889 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_052889.2, NP_443121.1 |
RefSeq Size | 758 bp |
RefSeq ORF | 294 bp |
Locus ID | 114769 |
UniProt ID | Q5EG05 |
Gene Summary | Caspase inhibitor. Acts as a regulator of procaspase-1/CASP1 activation implicated in the regulation of the proteolytic maturation of pro-interleukin-1 beta (IL1B) and its release during inflammation. Inhibits the release of IL1B in response to LPS in monocytes. Also induces NF-kappa-B activation during the pro-inflammatory cytokine response. Also able to inhibit CASP1-mediated neuronal cell death, TNF-alpha, hypoxia-, UV-, and staurosporine-mediated cell death but not ER stress-mediated cell death. Acts by preventing activation of caspases CASP1 and CASP4, possibly by preventing the interaction between CASP1 and RIPK2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) has an additional exon containing a stop codon in the middle region, as compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211537 | CARD16 (Myc-DDK-tagged)-Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2 |
CNY 1200.00 |
|
RC211537L3 | Lenti ORF clone of Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC211537L4 | Lenti ORF clone of Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG211537 | CARD16 (tGFP-tagged) - Human caspase recruitment domain family, member 16 (CARD16), transcript variant 2 |
CNY 2800.00 |