SHOX (NM_000451) Human Untagged Clone
CAT#: SC309059
SHOX (untagged)-Human short stature homeobox (SHOX), transcript variant 1
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GCFX; PHOG; SHOXY; SS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309059 representing NM_000451.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAGAGCTCACGGCTTTTGTATCCAAGTCTTTTGACCAGAAAAGCAAGGACGGTAACGGCGGAGGC GGAGGCGGCGGAGGTAAGAAGGATTCCATTACGTACCGGGAAGTTTTGGAGAGCGGACTGGCGCGCTCC CGGGAGCTGGGGACGTCGGATTCCAGCCTCCAGGACATCACGGAGGGCGGCGGCCACTGCCCGGTGCAT TTGTTCAAGGACCACGTAGACAATGACAAGGAGAAACTGAAAGAATTCGGCACCGCGAGAGTGGCAGAA GGGATTTATGAATGCAAAGAGAAGCGCGAGGACGTGAAGTCGGAGGACGAGGACGGGCAGACCAAGCTG AAACAGAGGCGCAGCCGCACCAACTTCACGCTGGAGCAGCTGAACGAGCTCGAGCGACTCTTCGACGAG ACCCATTACCCCGACGCCTTCATGCGCGAGGAGCTCAGCCAGCGCCTGGGGCTCTCCGAGGCGCGCGTG CAGGTTTGGTTCCAGAACCGGAGAGCCAAGTGCCGCAAACAAGAGAATCAGATGCATAAAGGCGTCATC TTGGGCACAGCCAACCACCTAGACGCCTGCCGAGTGGCACCCTACGTCAACATGGGAGCCTTACGGATG CCTTTCCAACAGGTCCAGGCTCAGCTGCAGCTGGAAGGCGTGGCCCACGCGCACCCGCACCTGCACCCG CACCTGGCGGCGCACGCGCCCTACCTGATGTTCCCCCCGCCGCCCTTCGGGCTGCCCATCGCGTCGCTG GCCGAGTCCGCCTCGGCCGCCGCCGTGGTCGCCGCCGCCGCCAAAAGCAACAGCAAGAATTCCAGCATC GCCGACCTGCGGCTCAAGGCGCGGAAGCACGCGGAGGCCCTGGGGCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_000451 |
Insert Size | 879 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000451.3 |
RefSeq Size | 3757 bp |
RefSeq ORF | 879 bp |
Locus ID | 6473 |
UniProt ID | O15266 |
Domains | homeobox, OAR |
Protein Families | Transcription Factors |
MW | 32.2 kDa |
Gene Summary | This gene belongs to the paired homeobox family and is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. Defects in this gene are associated with idiopathic growth retardation and in the short stature phenotype of Turner syndrome patients. This gene is highly conserved across species from mammals to fish to flies. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (SHOXa). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218605 | SHOX (Myc-DDK-tagged)-Human short stature homeobox (SHOX), transcript variant 1 |
CNY 2400.00 |
|
RC218605L1 | Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC218605L2 | Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC218605L3 | Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC218605L4 | Lenti ORF clone of Human short stature homeobox (SHOX), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG218605 | SHOX (tGFP-tagged) - Human short stature homeobox (SHOX), transcript variant 1 |
CNY 4000.00 |