GDF1 (NM_001492) Human Untagged Clone
CAT#: SC309037
GDF1 (untagged)-Human growth differentiation factor 1 (GDF1)
CNY 3656.00
CNY 6080.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CERS1; CHTD6; DORV; DTGA3; LAG1; LASS1; RAI; UOG1 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001492 edited
ATGCCACCGCCGCAGCAAGGTCCCTGCGGCCACCACCTCCTCCTCCTCCTGGCCCTGCTG CTGCCCTCGCTGCCCCTGACCCGCGCCCCCGTGCCCCCAGGCCCAGCCGCCGCCCTGCTC CAGGCTCTAGGACTGCGCGATGAGCCCCAGGGTGCCCCCAGGCTCCGGCCGGTTCCCCCG GTCATGTGGCGCCTGTTTCGACGCCGGGACCCCCAGGAGACCAGGTCTGGCTCGCGGCGG ACGTCCCCAGGGGTCACCCTGCAACCGTGCCACGTGGAGGAGCTGGGGGTCGCCGGAAAC ATCGTGCGCCACATCCCGGACCGCGGTGCGCCCACCCGGGCCTCGGAGCCTGCCTCGGCC GCGGGGCATTGCCCTGAGTGGACAGTCGTCTTCGACCTGTCGGCTGTGGAACCCGCTGAG CGCCCGAGCCGGGCCCGCCTGGAGCTGCGTTTCGCGGCGGCGGCGGCGGCAGCCCCGGAG GGCGGCTGGGAGCTGAGCGTGGCGCAAGCGGGCCAGGGCGCGGGCGCGGACCCCGGGCCG GTGCTGCTCCGCCAGTTGGTGCCCGCCCTGGGGCCGCCAGTGCGCGCGGAGCTGCTGGGC GCCGCTTGGGCTCGCAACGCCTCATGGCCGCGCAGCCTCCGCCTGGCGCTGGCGCTACGC CCCCGGGCCCCTGCCGCCTGCGCGCGCCTGGCCGAGGCCTCGCTGCTGCTGGTGACCCTC GACCCGCGCCTGTGCCACCCCCTGGCCCGGCCGCGGCGCGACGCCGAACCCGTGTTGGGC GGCGGCCCCGGGGGCGCTTGTCGCGCGCGGCGGCTGTACGTGAGCTTCCGCGAGGTGGGC TGGCACCGCTGGGTCATCGCGCCGCGCGGCTTCCTGGCCAACTACTGCCAGGGTCAGTGC GCGCTGCCCGTCGCGCTGTCGGGGTCCGGGGGGCCGCCGGCGCTCAACCACGCTGTGCTG CGCGCGCTCATGCACGCGGCCGCCCCGGGAGCCGCCGACCTGCCCTGCTGCGTGCCCGCG CGCCTGTCGCCCATCTCCGTGCTCTTCTTTCACAACAGCGACAACGTGGTGCTGCGGCAG TATGAGGACATGGTGGTGGACGAGTGCGGCTGCCGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001492 |
Insert Size | 2600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001492.3, NP_001483.2 |
RefSeq Size | 2565 bp |
RefSeq ORF | 1119 bp |
Locus ID | 2657 |
UniProt ID | P27539 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. Studies in rodents suggest that this protein is involved in the establishment of left-right asymmetry in early embryogenesis and in neural development in later embryogenesis. The encoded protein is translated from a bicistronic mRNA that also encodes ceramide synthase 1. Mutations in this gene are associated with several congenital cardiovascular malformations. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214424 | GDF1 (Myc-DDK-tagged)-Human growth differentiation factor 1 (GDF1) |
CNY 3656.00 |
|
RC214424L3 | Lenti ORF clone of Human growth differentiation factor 1 (GDF1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC214424L4 | Lenti ORF clone of Human growth differentiation factor 1 (GDF1), mGFP tagged |
CNY 5890.00 |
|
RG214424 | GDF1 (tGFP-tagged) - Human growth differentiation factor 1 (GDF1) |
CNY 4370.00 |