Betacellulin (BTC) (NM_001729) Human Untagged Clone
CAT#: SC309035
BTC (untagged)-Human betacellulin (BTC)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309035 representing NM_001729.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCGGGCCGCCCGGTGCAGCGGCGCCAGCTCCCTGCCACTGCTCCTGGCCCTTGCCCTGGGTCTA GTGATCCTTCACTGTGTGGTGGCAGATGGGAATTCCACCAGAAGTCCTGAAACTAATGGCCTCCTCTGT GGAGACCCTGAGGAAAACTGTGCAGCTACCACCACACAATCAAAGCGGAAAGGCCACTTCTCTAGGTGC CCCAAGCAATACAAGCATTACTGCATCAAAGGGAGATGCCGCTTCGTGGTGGCCGAGCAGACGCCCTCC TGTGTCTGTGATGAAGGCTACATTGGAGCAAGGTGTGAGAGAGTTGACTTGTTTTACCTAAGAGGAGAC AGAGGACAGATTCTGGTGATTTGTATGATAGCAGTTATGGTAGTTTTTATTATTTTGGTCATCGGTGTC TGCACATGCTGTCACCCTCTTCGGAAACGTCGTAAAAGAAAGAAGAAAGAAGAAGAAATGGAAACTCTG GGTAAAGATATAACTCCTATCAATGAAGATATTGAAGAGACAAATATTGCTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001729 |
Insert Size | 537 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001729.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001729.1 |
RefSeq Size | 1323 bp |
RefSeq ORF | 537 bp |
Locus ID | 685 |
UniProt ID | P35070 |
Domains | EGF |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | ErbB signaling pathway |
MW | 19.8 kDa |
Gene Summary | This gene encodes a member of the epidermal growth factor (EGF) family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the secreted growth factor. A secreted form and a membrane-anchored form of this protein bind to multiple different EGF receptors. This protein promotes pancreatic cell proliferation and insulin secretion, as well as retinal vascular permeability. Mutations in this gene may be associated with type 2 diabetes in human patients. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202483 | BTC (Myc-DDK-tagged)-Human betacellulin (BTC) |
CNY 2400.00 |
|
RC202483L1 | Lenti ORF clone of Human betacellulin (BTC), Myc-DDK-tagged |
CNY 4800.00 |
|
RC202483L2 | Lenti ORF clone of Human betacellulin (BTC), mGFP tagged |
CNY 5890.00 |
|
RC202483L3 | Lenti ORF clone of Human betacellulin (BTC), Myc-DDK-tagged |
CNY 4800.00 |
|
RC202483L4 | Lenti ORF clone of Human betacellulin (BTC), mGFP tagged |
CNY 4800.00 |
|
RG202483 | BTC (tGFP-tagged) - Human betacellulin (BTC) |
CNY 4000.00 |
其它Betacellulin产品