PSCA (NM_005672) Human Untagged Clone

CAT#: SC308973

PSCA (untagged)-Human prostate stem cell antigen (PSCA), transcript variant 1



  "NM_005672" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
PSCA Rabbit monoclonal antibody,clone OTIR4B1
    • 100 ul

CNY 1999.00
CNY 4070.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRO232
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_005672 edited
GTGACCATGAAGGCTGTGCTGCTTGCCCTGTTGATGGCAGGCTTGGCCCTGCAGCCAGGC
ACTGCCCTGCTGTGCTACTCCTGCAAAGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTG
GAGAACTGCACCCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCCGCGCAGTTGGCCTC
CTGACCGTCATCAGCAAAGGCTGCAGCTTGAACTGCGTGGATGACTCACAGGACTACTAC
GTGGGCAAGAAGAACATCACGTGCTGTGACACCGACTTGTGCAACGCCAGCGGGGCCCAT
GCCCTGCAGCCGGCTGCCGCCATCCTTGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGG
GGACCCGGCCAGCTATAGGCTCTGGGGGGCCCCGCTGCAGCCCACACTGGGTGTGGTGCC
CCAGGCCTCTGTGCCACTCCTCACAGACCTGGCCCAGTGGGAGCCTGTCCTGGTTCCTGA
GGCACATCCTAACGCAAGTCTGACCATGTATGTCTGCACCCCTGTCCCCCACCCTGACCC
TCCCATGGCCCTCTCCAGGACTCCCACCCGGCAGATCAGCTCTAGTGACACAGATCCGCC
TGCAGATGGCCCCTCCAACCCTCTCTGCTGCTGTTTCCATGGCCCAGCATTCTCCACCCT
TAACCCTGTGCTCAGGCACCTCTTCCCCCAGGAAGCCTTCCCTGCCCACCCCATCTATGA
CTTGAGCCAGGTCTGGTCCGTGGTGTCCCCCGCACCCAGCAGGGGACAGGCACTCAGGAG
GGCCCAGTAAAGGCTGAGATGAAGTGGACTGAGTAGAACTGGAGGACAAGAGTCGACGTG
AGTTCCTGGGAGTCTCCAGAGATGGGGCCTGGAGGCCTGGAGGAAGGGGCCAGGCCTCAC
ATTCGTGGGGCTCCCTGAATGGCAGCCTGAGCACAGCGTAGGCCCTTAATAAACACCTGT
TGGATAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005672
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005672.3.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005672.3, NP_005663.1
RefSeq Size 1064 bp
RefSeq ORF 372 bp
Locus ID 8000
UniProt ID O43653
Gene Summary This gene encodes a glycosylphosphatidylinositol-anchored cell membrane glycoprotein. In addition to being highly expressed in the prostate it is also expressed in the bladder, placenta, colon, kidney, and stomach. This gene is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. This gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...