OGG1 (NM_016819) Human Untagged Clone
CAT#: SC308888
OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HMMH; HOGG1; MUTM; OGH1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308888 representing NM_016819.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGG GCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCTGGACAATCTTTCCGG TGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGATCAAGTATGGACACTGACTCAGACT GAGGAGCAGCTCCACTGCACTGTGTACCGAGGAGACAAGAGCCAGGCTAGCAGGCCCACACCAGACGAG CTGGAGGCCGTGCGCAAGTACTTCCAGCTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCC GTGGACTCCCACTTCCAAGAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATC GAATGCCTTTTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGG CTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTCCCCAGCCTG CAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTGGGCTATCGTGCCCGTTAC GTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGCGGGCTAGCCTGGCTGCAGCAGCTACGAGAG TCCTCATATGAGGAGGCCCACAAGGCCCTCTGCATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGC ATCTGCCTGATGGCCCTAGACAAGCCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAA CGTGACTACAGCTGGCACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTG GGAAACTTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGAGTGTACCTAGGTGT CCTCCCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_016819 |
Insert Size | 975 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016819.3 |
RefSeq Size | 1896 bp |
RefSeq ORF | 975 bp |
Locus ID | 4968 |
UniProt ID | O15527 |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
MW | 36.4 kDa |
Gene Summary | This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008] Transcript Variant: Transcript variant 1b contains a 244 bp insertion between exons 6 and 7, as compared to the predominant transcript variant 1a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213394 | OGG1 (Myc-DDK-tagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b |
CNY 2400.00 |
|
RC213394L1 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b, Myc-DDK-tagged |
CNY 4800.00 |
|
RC213394L2 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b, mGFP tagged |
CNY 5890.00 |
|
RC213394L3 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b, Myc-DDK-tagged |
CNY 5890.00 |
|
RC213394L4 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b, mGFP tagged |
CNY 5890.00 |
|
RG213394 | OGG1 (tGFP-tagged) - Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1b |
CNY 4370.00 |