H2BC5 (NM_021063) Human Untagged Clone

CAT#: SC308828

HIST1H2BD (untagged)-Human histone cluster 1, H2bd (HIST1H2BD), transcript variant 1



  "NM_021063" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Acetyl-Histone H2B-K15 Rabbit polyclonal Antibody
    • 100 ul

CNY 2350.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ221C16.6; H2B.1B; H2B/a; H2B/b; H2B/g; H2B/h; H2B/k; H2B/l; H2BFA; H2BFB; H2BFG; H2BFH; H2BFK; H2BFL; HIRIP2; HIST1H2BC; HIST1H2BD; HIST1H2BE; HIST1H2BF; HIST1H2BG; HIST1H2BI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308828 representing NM_021063.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGAACCTACCAAGTCTGCTCCTGCCCCAAAGAAGGGCTCCAAGAAGGCGGTGACTAAGGCTCAG
AAGAAGGACGGGAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTATTCAGTGTATGTGTACAAGGTGCTG
AAGCAGGTCCATCCCGACACCGGCATCTCTTCCAAGGCAATGGGGATCATGAATTCCTTCGTCAACGAC
ATCTTCGAGCGCATCGCAGGCGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCC
AGGGAGATCCAGACGGCCGTGCGCCTGCTGCTTCCGGGGGAGCTGGCCAAGCACGCCGTGTCGGAGGGC
ACCAAGGCCGTCACCAAGTACACCAGTTCCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_021063
Insert Size 381 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021063.3
RefSeq Size 487 bp
RefSeq ORF 381 bp
Locus ID 3017
UniProt ID P62807
Protein Pathways Systemic lupus erythematosus
MW 13.9 kDa
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Two transcripts that encode the same protein have been identified for this gene, which is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (1) contains a palindromic termination sequence instead of a polyA signal and tail. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...