CSHL1 (NM_022579) Human Untagged Clone

CAT#: SC308812

CSHL1 (untagged)-Human chorionic somatomammotropin hormone-like 1 (CSHL1), transcript variant 1



  "NM_022579" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-CSHL1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CS-5; CSHP1; CSL; GHB4; hCS-L
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_022579, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCAGGCTCCCGGACGTCCCTGCTCCTGGCTTTTGCCCTGCTCTGCCTGCCCTGG
CTTCAAGAGGCTGGTGCCGTCCAAACCGTTCCCTTATCCAGGCTTTTTAAAGAGGCTATG
CTCCAAGCCCATCGCGCACACCAGCTGGCCATTGACACCTACCAGGAGTTTATAAGCTCT
TGGGGAATGGAAGCCTATATCACAAAGGAACAGAAGTATTCATTCCTGCATGACTCCCAG
ACCTCCTTCTGCTTCTCAGACTCTATTCCGACATCCTCCAACATGGAGGAAACGCAGCAG
AAATCCAACTTAGAGCTGCTCCACATCTCCCTGCTGCTCATCGAGTCGCGGCTGGAGCCC
GTGCGGTTCCTCAGGAGTACCTTCACCAACAACCTGGTGTATGACACCTCGGACAGCGAT
GACTATCACCTCCTAAAGGACCTAGAGGAAGGCATCCAAATGCTGATGGGGAGGCTGGAA
GACGGCAGCCACCTGACTGGGCAGACCCTCAAGCAGACCTACAGCAAGTTTGACACAAAC
TCGCACAACCATGACGCACTGCTCAAGAACTACGGGCTGCTCCACTGCTTCAGGAAGGAC
ATGGACAAGGTCGAGACATTCCTGCGCATGGTGCAGTGCCGCTCTGTGGAGGGCAGCTGT
GGCTTCTAG
Restriction Sites Please inquire     
ACCN NM_022579
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022579.1, NP_072101.1
RefSeq Size 837 bp
RefSeq ORF 669 bp
Locus ID 1444
UniProt ID Q14406
Protein Families Secreted Protein
Gene Summary The protein encoded by this gene is a member of the somatotropin/prolactin family of hormones which play an important role in growth control. The gene, along with four other related genes, is located at the growth hormone locus on chromosome 17 where they are interspersed in the same transcriptional orientation; an arrangement which is thought to have evolved by a series of gene duplications. Although the five genes share a remarkably high degree of sequence identity, they are expressed selectively in different tissues. This particular family member is expressed in placental villi, although it was originally thought to be a pseudogene. In fact, alternative splicing suggests that the majority of the transcripts would be unable to express a secreted protein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also known as CS-L(L'), represents the longest transcript, and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...