BLOC1S3 (NM_212550) Human Untagged Clone
CAT#: SC308648
BLOC1S3 (untagged)-Human biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BLOS3; HPS8; RP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_212550 edited
ATGGCGTCCCAGGGTCGTCGGCGGAGGCCCCTGCGGAGGCCGGAGACGGTGGTGCCGGGG GAGGCGACCGAGACGGATTCCGAGCGCTCTGCGTCCTCGTCGGAGGAGGAGGAGCTGTAC CTGGGTCCTTCGGGCCCGACGCGCGGCCGCCCCACGGGGCTGCGGGTGGCTGGGGAAGCC GCGGAGACCGACTCGGAGCCGGAGCCGGAGCCGGAACCGACGGCCGCGCCGAGGGACCTG CCTCCACTCGTGGTGCAGCGGGAATCGGCGGAGGAGGCCTGGGGCACGGAGGAGGCCCCG GCGCCCGCCCCCGCGCGCTCGCTCCTGCAACTTCGGCTGGCGGAGAGCCAGGCGCGGCTG GACCACGACGTGGCGGCCGCCGTGAGCGGTGTCTACCGCCGTGCAGGCCGCGACGTGGCC GCCCTGGCTAGTAGGCTGGCGGCAGCCCAGGCGGCGGGGCTGGCGGCGGCCCACAGCGTG CGCCTGGCGCGCGGGGACCTTTGTGCGCTGGCCGAGCGTCTGGACATCGTGGCTGGCTGC CGCCTGCTGCCGGACATCCGCGGCGTGCCAGGGACCGAGCCTGAGAAAGACCCGGGGCCG CGGGCCTAG |
Restriction Sites | NotI-NotI |
ACCN | NM_212550 |
Insert Size | 2400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_212550.2 |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_212550.1, NP_997715.1 |
RefSeq Size | 609 bp |
RefSeq ORF | 609 bp |
Locus ID | 388552 |
UniProt ID | Q6QNY0 |
Gene Summary | This gene encodes a protein that is a component of the BLOC1 multi-subunit protein complex. This complex is necessary for the biogenesis of specialized organelles of the endosomal-lysosomal system, including platelet dense granules and melanosomes. Mutations in this gene cause Hermansky-Pudlak syndrome 8, a disease characterized by lysosomal storage defects, bleeding due to platelet storage pool deficiency, and oculocutaneous albinism. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221221 | BLOC1S3 (Myc-DDK-tagged)-Human biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3) |
CNY 2400.00 |
|
RC221221L3 | Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3), Myc-DDK-tagged |
CNY 5890.00 |
|
RC221221L4 | Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3), mGFP tagged |
CNY 5890.00 |
|
RG221221 | BLOC1S3 (tGFP-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 3 (BLOC1S3) |
CNY 4000.00 |
其它BLOC1S3产品