PKC beta 1 (PRKCB) (NM_212535) Human Untagged Clone
CAT#: SC308645
PRKCB (untagged)-Human protein kinase C, beta (PRKCB), transcript variant 1
CNY 7384.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PKC-beta; PKCB; PKCbeta; PKCI(2); PRKCB1; PRKCB2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_212535 edited
GGCCGGCACCTCTCGGGCTCCGGCTCCCCGCGCGCAAGATGGCTGACCCGGCTGCGGGGC CGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTCGCCCGCAAAGGCGCCCTCCGGC AGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACCGCCCGCTTCTTCAAGCAGCCCA CCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTCGGGAAGCAGGGATTCCAGTGCC AAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAATTTGTCACATTCTCCTGCCCTG GCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGCAAACACAAGTTTAAGATCCACA CGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCACTGCTGTATGGACTCATCCACC AGGGGATGAAATGTGACACCTGCATGATGAATGTGCACAAGCGCTGCGTGATGAATGTTC CCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGCCGCATCTACATCCAGGCCCACA TCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCTAAAAACCTTGTACCTATGGACC CCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTGATTCCCGATCCCAAAAGTGAGA GCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAACCCTGAGTGGAATGAGACATTTA GATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTGTCAGTAGAGATTTGGGATTGGG ATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCCTTTGGGATTTCTGAACTTCAGA AAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAGGAGGAAGGCGAGTACTTCAATG TGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAACTGCGGCAGAAATTTGAGAGGG CCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAGACGACCAACACTGTCTCCAAAT TTGACAACAATGGCAACAGAGACCGGATGAAACTGACCGATTTTAACTTCCTAATGGTGC TGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAACGAAAAGGCACAGATGAGCTCT ATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAAGATGATGACGTGGAGTGCACTA TGGTGGAGAAGCGGGTGTTGGCCCTGCCCGGGAAGCCGCCCTTCCTGACCCAGCTCCACT CCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATGGAGTACGTGAATGGGGGCGACC TCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAGCCCCATGCTGTATTTTACGCTG CAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAGGGCATCATTTACCGTGACCTAA AACTTGACAACGTGATGCTCGATTCTGAGGGACACATCAAGATTGCCGATTTTGGCATGT GTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACATTCTGTGGCACTCCAGACTACA TCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAGTCCGTGGATTGGTGGGCATTTG GAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCCTTTGAAGGGGAGGATGAAGATG AACTCTTCCAATCCATCATGGAACACAACGTAGCCTATCCCAAGTCTATGTCCAAGGAAG CTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCAGGCAAACGTCTGGGTTGTGGAC CTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTCCGGTATATTGATTGGGAGAAAC TTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAAGCTAGAGACAAGAGAGACACCT CCAACTTCGACAAAGAGTTCACCAGACAGCCTGTGGAACTGACCCCCACTGATAAACTCT TCATCATGAACTTGGACCAAAATGAATTTGCTGGCTTCTCTTATACTAACCCAGAGTTTG TCATTAATGTGTAGGTGAATGCAAACTCCATCGTTGAGCCTGGGGTGTAAGACTTCAAGC C |
| Restriction Sites | Please inquire |
| ACCN | NM_212535 |
| Insert Size | 2100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_212535.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_212535.1, NP_997700.1 |
| RefSeq Size | 2319 bp |
| RefSeq ORF | 2016 bp |
| Locus ID | 5579 |
| UniProt ID | P05771 |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | B cell receptor signaling pathway, Calcium signaling pathway, Chemokine signaling pathway, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Leukocyte transendothelial migration, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Natural killer cell mediated cytotoxicity, Non-small cell lung cancer, Pathways in cancer, Phosphatidylinositol signaling system, Tight junction, Vascular smooth muscle contraction, VEGF signaling pathway, Vibrio cholerae infection, Wnt signaling pathway |
| Gene Summary | Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) uses an alternate splice junction at the 5' end of the last exon compared to variant 2. The resulting isoform (1) has a distinct and shorter C-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220599 | PRKCB (Myc-DDK-tagged)-Human protein kinase C, beta (PRKCB), transcript variant 1 |
CNY 7368.00 |
|
| RC220599L1 | Lenti ORF clone of Human protein kinase C, beta (PRKCB), transcript variant 1, Myc-DDK-tagged |
CNY 9768.00 |
|
| RC220599L2 | Lenti ORF clone of Human protein kinase C, beta (PRKCB), transcript variant 1, mGFP tagged |
CNY 9768.00 |
|
| RC220599L3 | Lenti ORF clone of Human protein kinase C, beta (PRKCB), transcript variant 1, Myc-DDK-tagged |
CNY 9030.00 |
|
| RC220599L4 | Lenti ORF clone of Human protein kinase C, beta (PRKCB), transcript variant 1, mGFP tagged |
CNY 9030.00 |
|
| RG220599 | PRKCB (tGFP-tagged) - Human protein kinase C, beta (PRKCB), transcript variant 1 |
CNY 7890.00 |
其它PKC beta 1产品
