RGS9BP (NM_207391) Human Untagged Clone
CAT＃: SC308506
RGS9BP (untagged)-Human regulator of G protein signaling 9 binding protein (RGS9BP)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PERRS; R9AP; RGS9 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308506 representing NM_207391.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGAGGGAGGAGTGCAAGGCGCTGCTGGACGGGCTCAACAAGACGACTGCGTGCTACCACCACCTG GTGCTGACCGTCGGTGGCTCGGCGGACTCGCAGAACCTGCGGCAGGAGCTGCAAAAGACGCGCCAGAAG GCGCAGGAGCTGGCGGTGTCCACCTGCGCCCGGCTGACTGCTGTGCTGCGCGACCGGGGCCTGGCCGCC GACGAGCGCGCCGAGTTCGAGCGGCTCTGGGTGGCCTTCTCGGGCTGCCTGGACCTGCTGGAAGCGGAC ATGCGACGCGCGCTGGAGCTGGGCGCCGCGTTCCCGCTGCACGCGCCGCGGCGGCCGCTGGTGCGCACA GGTGTGGCTGGCGCCTCCTCCGGCGTGGCGGCGCGCGCGCTGAGCACCCGCAGCCTGCGGCTCGAGGCG GAGGGCGACTTCGACGTCGCGGACCTGCGGGAGCTGGAGCGCGAGGTCCTTCAGGTGGGCGAGATGATC GACAACATGGAGATGAAGGTCAACGTGCCCCGCTGGACCGTGCAAGCCCGGCAGGCGGCGGGCGCCGAG CTCCTGTCCACGGTCAGCGCCGGCCCCTCCTCGGTCGTGTCCTTGCAGGAGCGCGGGGGGGGTTGCGAC CCCAGGAAGGCCCTGGCCGCCATCCTTTTCGGCGCCGTGCTGCTGGCGGCTGTGGCCCTAGCCGTGTGC GTGGCGAAGCTGAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_207391 |
| Insert Size | 708 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_207391.2 |
| RefSeq Size | 2894 bp |
| RefSeq ORF | 708 bp |
| Locus ID | 388531 |
| UniProt ID | Q6ZS82 |
| Protein Families | Transmembrane |
| MW | 25.1 kDa |
| Gene Summary | The protein encoded by this gene functions as a regulator of G protein-coupled receptor signaling in phototransduction. Studies in bovine and mouse show that this gene is expressed only in the retina, and is localized in the rod outer segment membranes. This protein is associated with a heterotetrameric complex, specifically interacting with the regulator of G-protein signaling 9, and appears to function as the membrane anchor for the other largely soluble interacting partners. Mutations in this gene are associated with prolonged electroretinal response suppression (PERRS), also known as bradyopsia. [provided by RefSeq, Mar 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218269 | RGS9BP (Myc-DDK-tagged)-Human regulator of G protein signaling 9 binding protein (RGS9BP) |
CNY 2400.00 |
|
| RC218269L3 | Lenti ORF clone of Human regulator of G protein signaling 9 binding protein (RGS9BP), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218269L4 | Lenti ORF clone of Human regulator of G protein signaling 9 binding protein (RGS9BP), mGFP tagged |
CNY 5890.00 |
|
| RG218269 | RGS9BP (tGFP-tagged) - Human regulator of G protein signaling 9 binding protein (RGS9BP) |
CNY 4370.00 |
