Endothelin 3 (EDN3) (NM_207032) Human Untagged Clone
CAT#: SC308367
EDN3 (untagged)-Human endothelin 3 (EDN3), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ET-3; ET3; HSCR4; PPET3; WS4B |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_207032, the custom clone sequence may differ by one or more nucleotides
ATGGAGCCGGGGCTGTGGCTCCTTTTCGGGCTCACAGTGACCTCCGCCGCAGGATTCGTG CCTTGCTCCCAGTCTGGGGATGCTGGCAGGCGCGGCGTGTCCCAGGCCCCCACTGCAGCC AGATCTGAGGGGGACTGTGAAGAGACTGTGGCTGGCCCTGGCGAGGAGACTGTGGCTGGC CCTGGCGAGGGGACTGTGGCCCCGACAGCACTGCAGGGTCCAAGCCCTGGAAGCCCTGGG CAGGAGCAGGCGGCCGAGGGGGCCCCTGAGCACCACCGATCCAGGCGCTGCACGTGCTTC ACCTACAAGGACAAGGAGTGTGTCTACTATTGCCACCTGGACATCATTTGGATCAACACT CCCGAACAGACGGTGCCCTATGGACTGTCCAACTACAGAGGAAGCTTCCGGGGCAAGAGG TCTGCGGGGCCACTTCCAGGGAATCTGCAGCTCTCACATCGGCCACACTTGCGCTGCGCT TGTGTGGGGAGATATGACAAGGCCTGCCTGCACTTTTGCACCCAAACTCTGGACGTCAGC AGTAATTCAAGGACGGCAGAAAAAACAGACAAAGAAGAGGAAGGGAAGGTGAGAGGTGCC AACAGAGGCCTGTGTCAAAGGAGGTTGAAGTCAAGGACCAACAAAGCAAGCAGGCTTTAG |
Restriction Sites | Please inquire |
ACCN | NM_207032 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_207032.1, NP_996915.1 |
RefSeq Size | 2694 bp |
RefSeq ORF | 660 bp |
Locus ID | 1908 |
UniProt ID | P14138 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a member of the endothelin family. Endothelins are endothelium-derived vasoactive peptides involved in a variety of biological functions. The active form of this protein is a 21 amino acid peptide processed from the precursor protein. The active peptide is a ligand for endothelin receptor type B (EDNRB). The interaction of this endothelin with EDNRB is essential for development of neural crest-derived cell lineages, such as melanocytes and enteric neurons. Mutations in this gene and EDNRB have been associated with Hirschsprung disease (HSCR) and Waardenburg syndrome (WS), which are congenital disorders involving neural crest-derived cells. Altered expression of this gene is implicated in tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 4. The encoded isoform (2), is shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208777 | EDN3 (Myc-DDK-tagged)-Human endothelin 3 (EDN3), transcript variant 2 |
CNY 3990.00 |
|
RC208777L3 | Lenti-ORF clone of EDN3 (Myc-DDK-tagged)-Human endothelin 3 (EDN3), transcript variant 2 |
CNY 5890.00 |
|
RC208777L4 | Lenti-ORF clone of EDN3 (mGFP-tagged)-Human endothelin 3 (EDN3), transcript variant 2 |
CNY 5890.00 |
|
RG208777 | EDN3 (tGFP-tagged) - Human endothelin 3 (EDN3), transcript variant 2 |
CNY 4370.00 |
其它Endothelin 3产品