MS4A7 (NM_206940) Human Untagged Clone
CAT#: SC308335
MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 4SPAN2; CD20L4; CFFM4; MS4A8 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_206940, the custom clone sequence may differ by one or more nucleotides
ATGCTATTACAATCCCAAACCATGGGGGTTTCTCACAGCTTTACACCAAAGGGCATCACT ATCCCTCAAAGAGAGAAACCTGGACACATGTACCAAAACGAAGATTACCTGCAGAACGGG CTGCCAACAGAAACCACCGTTCTTGGGTTTGGCATTACTGGATCCCTCTCAATTATCTCT GGAAAACAATCAACTAAGCCCTTTGACCTGAGCAGCTTGACCTCAAATGCAGTGAGTTCT GTTACTGCAGGAGCAGGCCTCTTCCTCCTTGCTGACAGCATGGTAGCCCTGAGGACTGCC TCTCAACATTGTGGCTCAGAAATGGATTATCTATCCTCATTGCCTTATTCGGAGTACTAT TATCCAATATATGAAATCAAAGATTGTCTCCTGACCAGTGTCAGTTTAACAGGTGTCCTA GTGGTGATGCTCATCTTCACTGTGCTGGAGCTCTTATTAGCTGCATACAGTTCTGTCTTT TGGTGGAAACAGCTCTACTCCAACAACCCTGGGAGTTCATTTTCCTCGACCCAGTCACAA GATCATATCCAACAGGTCAAAAAGAGTTCTTCACGGTCTTGGATATAA |
Restriction Sites | Please inquire |
ACCN | NM_206940 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_206940.1, NP_996823.1 |
RefSeq Size | 2841 bp |
RefSeq ORF | 588 bp |
Locus ID | 58475 |
UniProt ID | Q9GZW8 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) uses an alternate splice site for the first exon and lacks an in-frame coding exon compared to variant 1. The resulting isoform (2) lacks an internal region, as compared to isoform 1. Variants 4 and 2 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219524 | MS4A7 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
CNY 2400.00 |
|
RC219524L3 | Lenti-ORF clone of MS4A7 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
CNY 5890.00 |
|
RC219524L4 | Lenti-ORF clone of MS4A7 (mGFP-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
CNY 5890.00 |
|
RG219524 | MS4A7 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 4 |
CNY 4370.00 |