EEF1AKMT3 (NM_206914) Human Untagged Clone
CAT＃: SC308317
METTL21B (untagged)-Human methyltransferase like 21B (METTL21B), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FAM119B; METTL21B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308317 representing NM_206914.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGACCCCGGCCCAGATCCCGAATCTGAGTCGGAATCGGTGTTCCCGCGGGAGGTCGGGCTCTTT GCAGACTCTTACTCGGAGAAGAGCCAGTTCTGTTTCTGTGGGCATGTGCTGACCATCACGCAGAACTTT GGGTCCCGCCTCGGGGTGGCGGCGCGCGTGTGGGACGCGGCCCTGAGCCTGTGCAATTATTTCGAGAGT CAAAATGTGGATTTCCGAGGCAAGAAGGTGATCGAACTGGGTGCGGGGACAGGCATCGTGGGGATCTTG GCAGCGCTGCAGGGAGCTTATGGTCTAGTGAGGGAGACAGAGGACGATGTCATAGAACAAGAACTCTGG CGAGGTATGCGTGGAGCCTGTGGACATGCTCTATCCATGTCTACCATGACTCCCTGGGAATCCATCAAG GGAAGCTCTGTCAGGGGGGGATGTTACCATCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_206914 |
| Insert Size | 450 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_206914.1 |
| RefSeq Size | 2856 bp |
| RefSeq ORF | 450 bp |
| Locus ID | 25895 |
| UniProt ID | Q96AZ1 |
| MW | 16.2 kDa |
| Gene Summary | Protein-lysine methyltransferase that selectively methylates EEF1A1 and EEF1A2 at 'Lys-165' in an aminoacyl-tRNA and GTP-dependent manner. EEF1A1 methylation by EEF1AKMT3 is dynamic as well as inducible by stress conditions, such as ER-stress, and plays a regulatory role on mRNA translation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221825 | METTL21B (Myc-DDK-tagged)-Human methyltransferase like 21B (METTL21B), transcript variant 2 |
CNY 1200.00 |
|
| RC221825L3 | Lenti ORF clone of Human methyltransferase like 21B (METTL21B), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC221825L4 | Lenti ORF clone of Human methyltransferase like 21B (METTL21B), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG221825 | METTL21B (tGFP-tagged) - Human methyltransferase like 21B (METTL21B), transcript variant 2 |
CNY 4370.00 |
其它EEF1AKMT3产品
