GRB2 (NM_203506) Human Untagged Clone

CAT#: SC308219

GRB2 (untagged)-Human growth factor receptor-bound protein 2 (GRB2), transcript variant 2



  "NM_203506" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
GRB2 Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASH; EGFRBP-GRB2; Grb3-3; MST084; MSTP084; NCKAP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308219 representing NM_203506.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGCCATCGCCAAATATGACTTCAAAGCTACTGCAGACGACGAGCTGAGCTTCAAAAGGGGGGAC
ATCCTCAAGGTTTTGAACGAAGAATGTGATCAGAACTGGTACAAGGCAGAGCTTAATGGAAAAGACGGC
TTCATTCCCAAGAACTACATAGAAATGAAACCACATCCGTTTGGAAACGATGTGCAGCACTTCAAGGTG
CTCCGAGATGGAGCCGGGAAGTACTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTGGAT
TATCACAGATCTACATCTGTCTCCAGAAACCAGCAGATATTCCTGCGGGACATAGAACAGGTGCCACAG
CAGCCGACATACGTCCAGGCCCTCTTTGACTTTGATCCCCAGGAGGATGGAGAGCTGGGCTTCCGCCGG
GGAGATTTTATCCATGTCATGGATAACTCAGACCCCAACTGGTGGAAAGGAGCTTGCCACGGGCAGACC
GGCATGTTTCCCCGCAATTATGTCACCCCCGTGAACCGGAACGTCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_203506
Insert Size 531 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_203506.2
RefSeq Size 3181 bp
RefSeq ORF 531 bp
Locus ID 2885
UniProt ID P62993
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Dorso-ventral axis formation, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pathways in cancer, Prostate cancer, Renal cell carcinoma, T cell receptor signaling pathway
MW 20.6 kDa
Gene Summary The protein encoded by this gene binds the epidermal growth factor receptor and contains one SH2 domain and two SH3 domains. Its two SH3 domains direct complex formation with proline-rich regions of other proteins, and its SH2 domain binds tyrosine phosphorylated sequences. This gene is similar to the Sem5 gene of C.elegans, which is involved in the signal transduction pathway. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, as compared to variant 1. It encodes the shorter isoform (2) that lacks an internal segment, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...