RP9 (NM_203288) Human Untagged Clone
CAT＃: SC308100
RP9 (untagged)-Human retinitis pigmentosa 9 (autosomal dominant) (RP9)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PAP-1; PAP1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308100 representing NM_203288.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGTCCCGGCCTGGGCGCGAGGACGTGGGGGCTGCGGGCGCGCGGCGGCCGCGTGAGCCGCCGGAG CAGGAGCTGCAGCGACGTCGGGAGCAGAAGCGGCGGCGACACGACGCGCAGCAGCTGCAGCAGCTCAAG CACCTGGAGTCCTTTTACGAAAAACCTCCTCCTGGGCTTATCAAGGAAGATGAGACTAAGCCAGAAGAT TGCATACCAGATGTACCAGGCAATGAACACGCCAGGGAATTTCTGGCTCATGCACCAACTAAAGGACTT TGGATGCCACTGGGGAAAGAAGTCAAAGTTATGCAGTGTTGGCGTTGCAAACGCTATGGTCACCGAACG GGTGACAAAGAATGCCCTTTCTTTATCAAAGGCAACCAAAAGTTAGAGCAGTTCAGAGTGGCACATGAA GATCCCATGTATGACATCATACGAGACAATAAACGACATGAAAAGGACGTAAGGATACAGCAGTTAAAA CAGTTACTGGAGGATTCTACCTCAGATGAAGATAGGAGCAGCTCCAGTTCCTCTGAAGGTAAAGAGAAA CACAAGAAAAAGAAGAAGAAAGAAAAGCATAAGAAAAGGAAGAAAGAAAAGAAAAAGAAGAAAAAACGG AAGCACAAATCTTCCAAGTCAAATGAGGGTTCTGACTCAGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_203288 |
| Insert Size | 666 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_203288.1 |
| RefSeq Size | 1184 bp |
| RefSeq ORF | 666 bp |
| Locus ID | 6100 |
| UniProt ID | Q8TA86 |
| MW | 26.1 kDa |
| Gene Summary | The protein encoded by this gene can be bound and phosphorylated by the protooncogene PIM1 product, a serine/threonine protein kinase . This protein localizes in nuclear speckles containing the splicing factors, and has a role in pre-mRNA splicing. CBF1-interacting protein (CIR), a corepressor of CBF1, can also bind to this protein and effects alternative splicing. Mutations in this gene result in autosomal dominant retinitis pigmentosa-9. This gene has a pseudogene (GeneID: 441212), which is located in tandem array approximately 166 kb distal to this gene. [provided by RefSeq, Sep 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204944 | RP9 (Myc-DDK-tagged)-Human retinitis pigmentosa 9 (autosomal dominant) (RP9) |
CNY 2400.00 |
|
| RC204944L3 | Lenti ORF clone of Human retinitis pigmentosa 9 (autosomal dominant) (RP9), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204944L4 | Lenti ORF clone of Human retinitis pigmentosa 9 (autosomal dominant) (RP9), mGFP tagged |
CNY 5890.00 |
|
| RG204944 | RP9 (tGFP-tagged) - Human retinitis pigmentosa 9 (autosomal dominant) (RP9) |
CNY 4370.00 |
|
| SC321012 | RP9 (untagged)-Human retinitis pigmentosa 9 (autosomal dominant) (RP9) |
CNY 2400.00 |
