MAFA (NM_201589) Human Untagged Clone
CAT#: SC308064
MAFA (untagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA)
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | hMafA; INSDM; RIPE3b1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_201589 edited
ATGGCCGCGGAGCTGGCGATGGGCGCCGAGCTGCCCAGCAGCCCGCTGGCCATCGAGTAC GTCAACGACTTCGACCTGATGAAGTTCGAGGTGAAGAAGGAGCCTCCCGAGGCCGAGCGC TTCTGCCACCGCCTGCCGCCAGGCTCGCTGTCCTCGACGCCGCTCAGCACGCCCTGCTCC TCCGTGCCCTCCTCGCCCAGCTTCTGCGCGCCCAGCCCGGGCACCGGCGGCGGCGGCGGC GCGGGGGGCGGCGGCGGCTCGTCTCAGGCCGGGGGCGCCCCCGGGCCGCCGAGCGGGGGC CCCGGCGCCGTCGGGGGCACCTCGGGGAAGCCGGCGCTGGAGGATCTGTACTGGATGAGC GGCTACCAGCATCACCTCAACCCCGAGGCGCTCAACCTGACGCCCGAGGACGCGGTGGAG GCGCTCATCGGCAGCGGCCACCACGGCGCGCACCACGGCGCGCACCACCCGGCGGCCGCC GCAGCCTACGAGGCTTTCCGCGGCCCGGGCTTCGCGGGCGGCGGCGGAGCGGACGACATG GGCGCCGGCCACCACCACGGCGCGCACCACGCCGCCCACCACCACCACGCCGCCCACCAC CACCACCACCACCACCACCACCATGGCGGCGCGGGACACGGCGGTGGCGCGGGCCACCAC GTGCGCCTGGAGGAGCGCTTCTCCGACGACCAGCTGGTGTCCATGTCGGTGCGCGAGCTG AACCGGCAGCTCCGCGGCTTCAGCAAGGAGGAGGTCATCCGGCTCAAGCAGAAGCGGCGC ACGCTCAAGAACCGCGGCTACGCGCAGTCCTGCCGCTTCAAGCGGGTGCAGCAGCGGCAC ATTCTGGAGAGCGAGAAGTGCCAACTCCAGAGCCAGGTGGAGCAGCTGAAGCTGGAGGTG GGGCGCCTGGCCAAAGAGCGGGACCTGTACAAGGAGAAATACGAGAAGCTGGCGGGCCGG GGCGGCCCCGGGAGCGCGGGCGGGGCCGGTTTCCCGCGGGAGCCTTCGCCGCCGCAGGCC GGTCCCGGCGGGGCCAAGGGCACGGCCGACTTCTTCCTGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_201589 |
| Insert Size | 2600 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The final clone matches with NM_201589.2, and its ORF carries a SNP. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_201589.2, NP_963883.2 |
| RefSeq Size | 1062 bp |
| RefSeq ORF | 1062 bp |
| Locus ID | 389692 |
| UniProt ID | Q8NHW3 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
| Protein Pathways | Maturity onset diabetes of the young, Type II diabetes mellitus |
| Gene Summary | MAFA is a transcription factor that binds RIPE3b, a conserved enhancer element that regulates pancreatic beta cell-specific expression of the insulin gene (INS; MIM 176730) (Olbrot et al., 2002 [PubMed 12011435]).[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214782 | MAFA (Myc-DDK-tagged)-Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA) |
CNY 5488.00 |
|
| RC214782L1 | Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA), Myc-DDK-tagged |
CNY 7888.00 |
|
| RC214782L2 | Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA), mGFP tagged |
CNY 7888.00 |
|
| RC214782L3 | Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214782L4 | Lenti ORF clone of Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA), mGFP tagged |
CNY 7888.00 |
|
| RG214782 | MAFA (tGFP-tagged) - Human v-maf musculoaponeurotic fibrosarcoma oncogene homolog A (avian) (MAFA) |
CNY 7088.00 |
