CNN2 (NM_201277) Human Untagged Clone

CAT#: SC308007

CNN2 (untagged)-Human calponin 2 (CNN2), transcript variant 2



  "NM_201277" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CNN2 mouse monoclonal antibody, clone OTI2B5 (formerly 2B5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308007 representing NM_201277.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCCACGCAGTTCAACAAGGGCCCCTCGTACGGGCTGTCGGCCGAGGTCAAGAACCGGCTCCTG
TCCAAATATGACCCCCAGAAGGAGGCAGAGCTCCGCACCTGGATCGAGGGACTCACCGGCCTCTCCATC
GGCCCCGACTTCCAGAAGGGCCTGAAGGATGGAACTATCTTATGCACACTCATGAACAAGCTACAGCCG
GGCTCCGTCCCCAAGATCAACCGCTCCATGCAGAACTGGCACCAGCTAGAAAACCTGTCCAACTTCATC
AAGGCCATGGTCAGCTACGGCATGAACCCTGTGGACCTGTTCGAGGCCAACGACCTGTTTGAGAGTGGG
AACATGACGCAGGTGCAGGTGTCTCTTCTCGCCCTGGCGGGGAAGATGGGCACCAACAAATGCGCCAGC
CAGTCGGGCATGACTGCCTACGGCACGAGAAGGCATCTCTATGACCCCAAGAACCATATCCTGCCCCCC
ATGGACCACTCGACCATCAGCCTCCAGATGGGCACGAACAAGTGTGCCAGCCAGGTGGGCATGACGGCT
CCCGGGACCCGGCGGCACATCTATGATACCAAGCTGGGAACCGACAAGTGTGACAACTCCTCCATGTCC
CTGCAGATGGGCTACACGCAGGGCGCCAACCAGAGCGGCCAGGTCTTCGGCCTGGGCCGGCAGATATAT
GACCCCAAGTACTGCCCGCAAGGCACAGTGGCCGATGGGGCTCCCTCGGGCACCGGCGACTGCCCGGAC
CCGGGGGAGGTCCCTGAATATCCCCCTTACTACCAGGAGGAGGCCGGCTACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_201277
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_201277.2
RefSeq Size 2391 bp
RefSeq ORF 813 bp
Locus ID 1265
UniProt ID Q99439
MW 29.5 kDa
Gene Summary The protein encoded by this gene, which can bind actin, calmodulin, troponin C, and tropomyosin, may function in the structural organization of actin filaments. The encoded protein could play a role in smooth muscle contraction and cell adhesion. Several pseudogenes of this gene have been identified, and are present on chromosomes 1, 2, 3, 6, 9, 11, 13, 15, 16, 21 and 22. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 4. The encoded isoform (b) is shorter than isoform d. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...