COLEC11 (NM_199235) Human Untagged Clone
CAT#: SC307907
COLEC11 (untagged)-Human collectin sub-family member 11 (COLEC11), transcript variant 2
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 3MC2; CL-11; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307907 representing NM_199235.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACGCCTGCTCTGTGCAGATCCTCGTCCCTGGCCTCAAAGGGGATGCGGGAGAGAAGGGAGACAAAG GCGCCCCCGGACGGCCTGGAAGAGTCGGCCCCACGGGAGAAAAAGCAGTCACAGCCAGTCGTGACAGCT TCTGACATCTCCAAAAGGAAGTGCACCTCGTCCTTTGTAGAAATGGGATCACAGGGAGACATGGGGGAC AAAGGACAGAAAGGCAGTGTGGGTCGTCATGGAAAAATTGGTCCCATTGGCTCTAAAGGTGAGAAAGGA GATTCCGGTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGCCAGCTG CGCAAGGCCATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATCAAGAAT GCTGTCGCCGGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGCTACGCG GACGCCCAGCTGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCCAATGGC CTGATGGCCGCATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTGGAGAAG GAGGGCGCCTTCGTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGTGAGCCC AACAATGCCTACGACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTGGCCTGC CACACCACCATGTACTTCATGTGTGAGTTTGACAAGGAGAACATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_199235 |
| Insert Size | 807 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199235.2 |
| RefSeq Size | 1784 bp |
| RefSeq ORF | 807 bp |
| Locus ID | 78989 |
| UniProt ID | Q9BWP8 |
| MW | 29 kDa |
| Gene Summary | This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) includes an alternate exon in the 3' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) is shorter and has a distinct N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203199 | COLEC11 (Myc-DDK-tagged)-Human collectin sub-family member 11 (COLEC11), transcript variant 2 |
CNY 2400.00 |
|
| RC203199L3 | Lenti ORF clone of Human collectin sub-family member 11 (COLEC11), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC203199L4 | Lenti ORF clone of Human collectin sub-family member 11 (COLEC11), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG203199 | COLEC11 (tGFP-tagged) - Human collectin sub-family member 11 (COLEC11), transcript variant 2 |
CNY 4000.00 |
其它COLEC11产品
