GDNF (NM_199234) Human Untagged Clone
CAT#: SC307906
GDNF (untagged)-Human glial cell derived neurotrophic factor (GDNF), transcript variant 3
CNY 1200.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | astrocyte-derived trophic factor; ATF1; ATF2; glial cell derived neurotrophic factor; glial cell line derived neurotrophic factor; glial derived neurotrophic factor; HFB1-GDNF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_199234 edited
ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTC CCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACC GGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAA CCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGT ACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGC AGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGG TTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA >OriGene 5' read for NM_199234 unedited
GGGTTTGCATTTGTATACCACTCCTATAGGGCGGCCGCGATTCCTGCAGCCCGGGGGATC CGCCCATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCG CCTTCCCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAA AAACCGGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTA TGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGAC AACGTACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGT AGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAA CCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGAGGGCT AGAGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCC TCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTA ATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGG AGGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTNAGGCCTGCGGGGT CTATTGGGAACCAAGCTGGAGTGCAGTGGCACCATCTTGGCTCACTGCAATCTCCGCCTC CTGGGTTCAAGCGATTCTCCTGCCTTAGCCTCCCCGATTGTTGGGATTCCAGGCATGCCT GACCCGGCTCAACTAATTTTTGGTTTTTTGGTAAAAACGGGGTTTACCCTTTTTGGCCAG |
Restriction Sites | Please inquire |
ACCN | NM_199234 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_199234.1, NP_954704.1 |
RefSeq Size | 410 bp |
RefSeq ORF | 402 bp |
Locus ID | 2668 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (3) lacks an alternate segment in the 5' UTR and uses a downstream start codon, compared to variant 1. Isoform 3 has a shorter and distinct N-terminus, compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
GDNF-expressing macrophages restore motor functions at a severe late-stage, and produce long-term neuroprotective effects at an early-stage of Parkinson\'s disease in transgenic Parkin Q311X(A) mice
,Zhao, Y;Haney, MJ;Jin, YS;Uvarov, O;Vinod, N;Lee, YZ;Langworthy, B;Fine, JP;Rodriguez, M;El-Hage, N;Kabanov, AV;Batrakova, EV;,
J Control Release
,PubMed ID 31678095
[GDNF]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221484 | GDNF (Myc-DDK-tagged)-Human glial cell derived neurotrophic factor (GDNF), transcript variant 3 |
CNY 1200.00 |
|
RC221484L1 | Lenti ORF clone of Human glial cell derived neurotrophic factor (GDNF), transcript variant 3, Myc-DDK-tagged |
CNY 3600.00 |
|
RC221484L2 | Lenti ORF clone of Human glial cell derived neurotrophic factor (GDNF), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RC221484L3 | Lenti ORF clone of Human glial cell derived neurotrophic factor (GDNF), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC221484L4 | Lenti ORF clone of Human glial cell derived neurotrophic factor (GDNF), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG221484 | GDNF (tGFP-tagged) - Human glial cell derived neurotrophic factor (GDNF), transcript variant 3 |
CNY 2800.00 |