GDNF (NM_199234) Human Untagged Clone

CAT#: SC307906

GDNF (untagged)-Human glial cell derived neurotrophic factor (GDNF), transcript variant 3



  "NM_199234" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-GDNF
    • 50 ul

CNY 11000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms astrocyte-derived trophic factor; ATF1; ATF2; glial cell derived neurotrophic factor; glial cell line derived neurotrophic factor; glial derived neurotrophic factor; HFB1-GDNF
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_199234 edited
ATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCGCCTTC
CCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAAAAACC
GGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTATGAAA
CCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGACAACGT
ACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGTAGGGC
AGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAACCTGG
TTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGA
>OriGene 5' read for NM_199234 unedited
GGGTTTGCATTTGTATACCACTCCTATAGGGCGGCCGCGATTCCTGCAGCCCGGGGGATC
CGCCCATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGCTGCTCCACACCGCGTCCG
CCTTCCCGCTGCCAACCCAGAGAATTCCAGAGGAAAAGGTCGGAGAGGCCAGAGGGGCAA
AAACCGGGGTTGTGTCTTAACTGCAATACATTTAAATGTCACTGACTTGGGTCTGGGCTA
TGAAACCAAGGAGGAACTGATTTTTAGGTACTGCAGCGGCTCTTGCGATGCAGCTGAGAC
AACGTACGACAAAATATTGAAAAACTTATCCAGAAATAGAAGGCTGGTGAGTGACAAAGT
AGGGCAGGCATGTTGCAGACCCATCGCCTTTGATGATGACCTGTCGTTTTTAGATGATAA
CCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAAAGGTGTGGATGTATCTGAGGGCT
AGAGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCC
TCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTA
ATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGG
AGGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTNAGGCCTGCGGGGT
CTATTGGGAACCAAGCTGGAGTGCAGTGGCACCATCTTGGCTCACTGCAATCTCCGCCTC
CTGGGTTCAAGCGATTCTCCTGCCTTAGCCTCCCCGATTGTTGGGATTCCAGGCATGCCT
GACCCGGCTCAACTAATTTTTGGTTTTTTGGTAAAAACGGGGTTTACCCTTTTTGGCCAG
Restriction Sites Please inquire     
ACCN NM_199234
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_199234.1, NP_954704.1
RefSeq Size 410 bp
RefSeq ORF 402 bp
Locus ID 2668
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Mutations in this gene may be associated with Hirschsprung disease and Tourette syndrome. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (3) lacks an alternate segment in the 5' UTR and uses a downstream start codon, compared to variant 1. Isoform 3 has a shorter and distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...