VAX1 (NM_199131) Human Untagged Clone

CAT#: SC307872

VAX1 (untagged)-Human ventral anterior homeobox 1 (VAX1), transcript variant 2



  "NM_199131" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
VAX1 mouse monoclonal antibody,clone OTI4E5
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MCOPS11
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307872 representing NM_199131.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCGGGAAACCAGACAAAATGGACGTTCGATGCCACTCGGACGCCGAGGCTGCCCGGGTCTCGAAG
AACGCGCACAAGGAGAGTCGGGAGAGCAAGGGCGCGGAGGGGAACCTCCCAGCCGCCTTCCTCAAGGAG
CCGCAGGGCGCCTTCTCAGCGTCGGGCGCTGCTGAGGATTGTAACAAAAGTAAATCCAATTCCGCAGCG
GACCCGGATTACTGCCGCCGGATCCTGGTCCGAGATGCCAAGGGGTCCATCCGAGAGATCATCCTGCCC
AAGGGCCTGGACTTGGACCGGCCTAAGAGGACGCGCACGTCCTTCACCGCGGAGCAGCTCTATCGGCTG
GAGATGGAGTTCCAGCGCTGCCAGTACGTGGTGGGCCGCGAGAGGACCGAGCTCGCCCGGCAGCTTAAC
CTCTCCGAGACCCAGGCAAATAGTGAAGAAAATAATGAACGATTCAAACGCGGGATAAAAAAACAAAAG
AAGAAAAGGAAGAAAGAGCCAGCAAATGATGAGTCTCGGCGTGGGGACTCCGGGGGCAGAGGGTGGCAG
CCCCTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199131
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_199131.2
RefSeq Size 4494 bp
RefSeq ORF 561 bp
Locus ID 11023
UniProt ID Q5SQQ9
Protein Families Transcription Factors
MW 21 kDa
Gene Summary This gene encodes a homeo-domain containing protein from a class of homeobox transcription factors which are conserved in vertebrates. Genes of this family are involved in the regulation of body development and morphogenesis. The most conserved genes, called HOX genes are found in special gene clusters. This gene belongs to the VAX subfamily and lies in the vicinity of the EMX homeobox gene family. Another member of VAX family is located on chromosome 2. The encoded protein may play an important role in the development of anterior ventral forebrain and visual system. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 3' coding region and UTR compared to variant 1. The resulting isoform (b) has a shorter C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by orthologous data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...