VWA1 (NM_199121) Human Untagged Clone
CAT＃: SC307865
VWA1 (untagged)-Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | WARP |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307865 representing NM_199121.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTCCCCTGGACGGCGCTCGGCCTGGCCCTGAGCTTGCGGCTGGCGCTGGCGCGGAGCGGCGCGGAG CGCGGAGCTCAAGGACCTGGGCGTCACCGTGTTCATTGTCAGCACCGGCCGAGGCAACTTCCTGGAGCT GTCAGCCGCTGCCTCAGCCCCTGCCGAGAAGCACCTGCACTTTGTGGACGTGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_199121 |
| Insert Size | 195 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_199121.2 |
| RefSeq Size | 4264 bp |
| RefSeq ORF | 195 bp |
| Locus ID | 64856 |
| UniProt ID | Q6PCB0 |
| MW | 6.8 kDa |
| Gene Summary | VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010] Transcript Variant: This variant (2) uses an alternate splice site that causes a frameshift in the central coding region, compared to variant 1. The encoded isoform (2) has a significantly shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214460 | VWA1 (Myc-DDK-tagged)-Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2 |
CNY 1200.00 |
|
| RC214460L3 | Lenti ORF clone of Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214460L4 | Lenti ORF clone of Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG214460 | VWA1 (tGFP-tagged) - Human von Willebrand factor A domain containing 1 (VWA1), transcript variant 2 |
CNY 4370.00 |
