THAP1 (NM_199003) Human Untagged Clone
CAT#: SC307848
THAP1 (untagged)-Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DYT6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307848 representing NM_199003.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGCAGTCCTGCTCCGCCTACGGCTGCAAGAACCGCTACGACAAGGACAAGCCCGTTTCTTTCCAC AAAAAGAAGATCTTCTGGAGCCACAGGAACAGCTTCCCCCACCTCCTTTACCGCCTCCTGTTTCCCAGG TTGATGCTGCTATTGGATTACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_199003 |
Insert Size | 162 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_199003.1 |
RefSeq Size | 1993 bp |
RefSeq ORF | 162 bp |
Locus ID | 55145 |
UniProt ID | Q9NVV9 |
MW | 6.5 kDa |
Gene Summary | The protein encoded by this gene contains a THAP domain, a conserved DNA-binding domain. This protein colocalizes with the apoptosis response protein PAWR/PAR-4 in promyelocytic leukemia (PML) nuclear bodies, and functions as a proapoptotic factor that links PAWR to PML nuclear bodies. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks a coding exon compared to variant 1, which causes a frameshift. The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222957 | THAP1 (Myc-DDK-tagged)-Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2 |
CNY 1200.00 |
|
RC222957L1 | Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, Myc-DDK-tagged |
CNY 3600.00 |
|
RC222957L2 | Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC222957L3 | Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222957L4 | Lenti ORF clone of Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG222957 | THAP1 (tGFP-tagged) - Human THAP domain containing, apoptosis associated protein 1 (THAP1), transcript variant 2 |
CNY 4370.00 |