CLEC4G (NM_198492) Human Untagged Clone
CAT＃: SC307722
CLEC4G (untagged)-Human C-type lectin domain family 4, member G (CLEC4G)
CNY 2400.00
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DTTR431; LP2698; LSECtin; UNQ431 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_198492 edited
GTGGGCTGGGTGCCTGCATCGCCATGGACACCACCAGGTACAGCAAGTGGGGCGGCAGCT CCGAGGAGGTCCCCGGAGGGCCCTGGGGACGCTGGGTGCACTGGAGCAGGAGACCCCTCT TCTTGGCCCTGGCTGTCCTGGTCACCACAGTCCTTTGGGCTGTGATTCTGAGTATCCTAT TGTCCAAGGCCTCCACGGAGCGCGCGGCGCTGCTTGACGGCCACGACCTGCTGAGGACAA ACGCCTCGAAGCAGACGGCGGCGCTGGGTGCCCTGAAGGAGGAGGTCGGAGACTGCCACA GCTGCTGCTCGGGGACGCAGGCGCAGCTGCAGACCACGCGCGCGGAGCTTGGGGAGGCGC AGGCGAAGCTGATGGAGCAGGAGAGCGCCCTGCGGGAACTGCGTGAGCGCGTGACCCAGG GCTTGGCTGAAGCCGGCAGGGGCCGTGAGGACGTCCGCACTGAGCTGTTCCGGGCGCTGG AGGCCGTGAGGCTCCAGAACAACTCCTGCGAGCCGTGCCCCACGTCGTGGCTGTCCTTCG AGGGCTCCTGCTACTTTTTCTCTGTGCCAAAGACGACGTGGGCGGCGGCGCAGGATCACT GCGCAGATGCCAGCGCGCACCTGGTGATCGTTGGGGGCCTGGATGAGCAGGGCTTCCTCA CTCGGAACACGCGTGGCCGTGGTTACTGGCTGGGCCTGAGGGCTGTGCGCCATCTGGGCA AGGTTCAGGGCTACCAGTGGGTGGACGGAGTCTCTCTCAGCTTCAGCCACTGGAACCAGG GAGAGCCCAATGACGCTTGGGGGCGCGAGAACTGTGTCATGATGCTGCACACGGGGCTGT GGAACGACGCACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAGAAAAGGCACAACT GCTGACCCCGCCCAGTGCCCTGGAGCCGCGCCCATTGCAGCATGTCGTATCCTGGGGGCT GCTCACCTCCCTGGCTCCTG |
| Restriction Sites | Please inquire |
| ACCN | NM_198492 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198492.1, NP_940894.1 |
| RefSeq Size | 1355 bp |
| RefSeq ORF | 882 bp |
| Locus ID | 339390 |
| UniProt ID | Q6UXB4 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a glycan-binding receptor and member of the C-type lectin family which plays a role in the immune response. C-type lectin receptors are pattern recognition receptors located on immune cells that play a role in the recognition and uptake of both self and non-self glycoproteins as well as mediating cell adhesion, glycoprotein clearance, and cell signaling functions. This gene's protein binds complex-type N-glycans of the viral envelope proteins of Ebola virus, West Nile filovirus, and SARS coronavirus, but not HIV or hepatitis C virus. In mouse, this protein has been shown to recognize activated T-cells and to negatively regulate T-cell receptor-mediated signalling. It also acts as a novel, liver-specific regulator of NK cell-mediated immunity in mouse. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2020] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210798 | CLEC4G (Myc-DDK-tagged)-Human C-type lectin domain family 4, member G (CLEC4G) |
CNY 2400.00 |
|
| RC210798L3 | Lenti ORF clone of Human C-type lectin domain family 4, member G (CLEC4G), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC210798L4 | Lenti ORF clone of Human C-type lectin domain family 4, member G (CLEC4G), mGFP tagged |
CNY 5890.00 |
|
| RG210798 | CLEC4G (tGFP-tagged) - Human C-type lectin domain family 4, member G (CLEC4G) |
CNY 4370.00 |
