ING3 (NM_198267) Human Untagged Clone
CAT＃: SC307660
ING3 (untagged)-Human inhibitor of growth family, member 3 (ING3), transcript variant 3
CNY 3990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Eaf4; ING2; MEAF4; p47ING3 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_198267, the custom clone sequence may differ by one or more nucleotides
ATGTTGTACCTAGAAGACTATCTGGAAATGATTGAGCAGCTTCCTATGGATCTGCGGGAC CGCTTCACGGAAATGCGCGAGATGGACCTGCAGGTGCAGAATGCAATGGATCAACTAGAA CAAAGAGTCAGTGAATTCTTTATGAATGCAAAGAAAAATAAACCTGAGTGGAGGGAAGAG CAAATGGCATCCATCAAAAAAGACTACTATAAAGCTTTGGAAGATGCAGATGAGAAGGTT CAGTTGGCAAACCAGATATATGACTTGCAGCACTTCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_198267 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198267.1, NP_938008.1 |
| RefSeq Size | 1240 bp |
| RefSeq ORF | 279 bp |
| Locus ID | 54556 |
| UniProt ID | Q9NXR8 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) uses a different segment in its 3' coding region and UTR, compared to variant 1, with a resulting frameshift. The predicted isoform (3) has a distinct and shorter C-terminus, as compared to isoform 1. This transcript is supported by several ESTs, but the predicted ORF has not yet been experimentally confirmed. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211752 | ING3 (Myc-DDK-tagged)-Human inhibitor of growth family, member 3 (ING3), transcript variant 3 |
CNY 3990.00 |
|
| RC211752L3 | Lenti-ORF clone of ING3 (Myc-DDK-tagged)-Human inhibitor of growth family, member 3 (ING3), transcript variant 3 |
CNY 5890.00 |
|
| RC211752L4 | Lenti-ORF clone of ING3 (mGFP-tagged)-Human inhibitor of growth family, member 3 (ING3), transcript variant 3 |
CNY 5890.00 |
|
| RG211752 | ING3 (tGFP-tagged) - Human inhibitor of growth family, member 3 (ING3), transcript variant 3 |
CNY 4370.00 |
