QRFP (NM_198180) Human Untagged Clone
CAT＃: SC307641
QRFP (untagged)-Human pyroglutamylated RFamide peptide (QRFP)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 26RFa; P518 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307641 representing NM_198180.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTAAGGCCTTACCCCCTGATCTACTTCCTCTTCCTGCCGCTGGGCGCCTGCTTCCCTCTACTGGAC AGAAGAGAGCCCACAGACGCCATGGGTGGCCTCGGAGCTGGAGAACGCTGGGCCGACCTGGCCATGGGG CCCCGACCCCACTCCGTGTGGGGTTCCTCTCGGTGGCTGAGAGCTTCACAGCCACAGGCCCTGCTTGTC ATAGCCAGGGGGCTGCAGACATCGGGCAGAGAGCATGCTGGCTGCAGATTCCGCTTCGGGAGGCAGGAC GAAGGCAGTGAGGCCACCGGCTTCCTCCCTGCTGCGGGGGAGAAGACCAGCGGCCCGTTAGGGAACCTG GCTGAGGAGCTCAATGGCTACAGCAGGAAGAAAGGCGGCTTCAGCTTCCGCTTCGGTCGGCGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_198180 |
| Insert Size | 411 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198180.2 |
| RefSeq Size | 932 bp |
| RefSeq ORF | 411 bp |
| Locus ID | 347148 |
| UniProt ID | P83859 |
| MW | 14.9 kDa |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. The encoded products are members of the RFamide family of neuropeptides, characterized by their common protein C-terminus consisting of an arginine (R) and an amidated phenylalanine (F). These products include the neuropeptides 26RFa and the N-terminally extended form, 43RFa. Both of these neuropeptides bind to the pyroglutamylated RFamide peptide receptor (QRFPR) and may regulate blood pressure, reproduction and food intake in rodents. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218501 | QRFP (Myc-DDK-tagged)-Human pyroglutamylated RFamide peptide (QRFP) |
CNY 1200.00 |
|
| RC218501L3 | Lenti ORF clone of Human pyroglutamylated RFamide peptide (QRFP), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218501L4 | Lenti ORF clone of Human pyroglutamylated RFamide peptide (QRFP), mGFP tagged |
CNY 5890.00 |
|
| RG218501 | QRFP (tGFP-tagged) - Human pyroglutamylated RFamide peptide (QRFP) |
CNY 4370.00 |
