MITF (NM_198178) Human Untagged Clone
CAT#: SC307640
MITF (untagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6
CNY 3656.00
CNY 5800.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHe32; CMM8; COMMAD; MI; WS2; WS2A |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_198178 edited
AAACATTGTTATGCTGGAAATGCTAGAATATAATCACTATCAGGTGCAGACCCACCTCGA AAACCCCACCAAGTACCACATACAGCAAGCCCAACGGCAGCAGGTAAAGCAGTACCTTTC TACCACTTTAGCAAATAAACATGCCAACCAAGTCCTGAGCTTGCCATGTCCAAACCAGCC TGGCGATCATGTCATGCCACCGGTGCCGGGGAGCAGCGCACCCAACAGCCCCATGGCTAT GCTTACGCTTAACTCCAACTGTGAAAAAGAGGGATTTTATAAGTTTGAAGAGCAAAACAG GGCAGAGAGCGAGTGCCCAGGCATGAACACACATTCACGAGCGTCCTGTATGCAGATGGA TGATGTAATCGATGACATCATTAGCCTAGAATCAAGTTATAATGAGGAAATCTTGGGCTT GATGGATCCTGCTTTGCAAATGGCAAATACGTTGCCTGTCTCGGGAAACTTGATTGATCT TTATGGAAACCAAGGTCTGCCCCCACCAGGCCTCACCATCAGCAACTCCTGTCCAGCCAA CCTTCCCAACATAAAAAGGGAGCTCACAGAGTCTGAAGCAAGAGCACTGGCCAAAGAGAG GCAGAAAAAGGACAATCACAACCTGATTGAACGAAGAAGAAGATTTAACATAAATGACCG CATTAAAGAACTAGGTACTTTGATTCCCAAGTCAAATGATCCAGACATGCGCTGGAACAA GGGAACCATCTTAAAAGCATCCGTGGACTATATCCGAAAGTTGCAACGAGAACAGCAACG CGCAAAAGAACTTGAAAACCGACAGAAGAAACTGGAGCACGCCAACCGGCATTTGTTGCT CAGAATACAGGAACTTGAAATGCAGGCTCGAGCTCATGGACTTTCCCTTATTCCATCCAC GGGTCTCTGCTCTCCAGATTTGGTGAATCGGATCATCAAGCAAGAACCCGTTCTTGAGAA CTGCAGCCAAGACCTCCTTCAGCATCATGCAGACCTAACCTGTACAACAACTCTCGATCT CACGGATGGCACCATCACCTTCAACAACAACCTCGGAACTGGGACTGAGGCCAACCAAGC CTATAGTGTCCCCACAAAAATGGGATCCAAACTGGAAGACATCCTGATGGACGACACCCT TTCTCCCGTCGGTGTCACTGATCCACTCCTTTCCTCAGTGTCCCCCGGAGCTTCCAAAAC AAGCAGCCGGAGGAGCAGTATGAGCATGGAAGAGACGGAGCACACTTGTTAGCGAATCCT CCCTGCACTGCATTCGCACAAACTGCTTCCTTTCTTGATT |
Restriction Sites | Please inquire |
ACCN | NM_198178 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198178.1, NP_937821.1 |
RefSeq Size | 4597 bp |
RefSeq ORF | 1488 bp |
Locus ID | 4286 |
UniProt ID | O75030 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Melanogenesis, Melanoma, Pathways in cancer |
Gene Summary | The protein encoded by this gene is a transcription factor that contains both basic helix-loop-helix and leucine zipper structural features. The encoded protein regulates melanocyte development and is responsible for pigment cell-specific transcription of the melanogenesis enzyme genes. Heterozygous mutations in the this gene cause auditory-pigmentary syndromes, such as Waardenburg syndrome type 2 and Tietz syndrome. [provided by RefSeq, Aug 2017] Transcript Variant: This variant (6) differs in the 5' UTR and the 5' coding region, and uses two alternate, in-frame splice sites in the coding region compared to variant 1. The resulting isoform (6), also known as isoform MITF-Mdel, has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222074 | MITF (Myc-DDK-tagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 3656.00 |
|
RC222074L1 | Lenti-ORF clone of MITF (Myc-DDK-tagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 6056.00 |
|
RC222074L2 | Lenti-ORF clone of MITF (mGFP-tagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 5890.00 |
|
RC222074L3 | Lenti-ORF clone of MITF (Myc-DDK-tagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 5890.00 |
|
RC222074L4 | Lenti-ORF clone of MITF (mGFP-tagged)-Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 5890.00 |
|
RG222074 | MITF (tGFP-tagged) - Human microphthalmia-associated transcription factor (MITF), transcript variant 6 |
CNY 4370.00 |